HOW POLYPEPTIDES ARE FORMED?

A polypeptide of 600 amino acids will be coded for by a linear-sequence of how many bases in (a) mRNA and (b) DNA?

Assertion. A single mRNA strand is capable of forming a number of different polypeptide chains. Reason. The mRNA strand has terminator codons.

Insulin (bovine) has 51 amino acids in A and B polypeptides. The polypeptide A possesses amino acids

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

The genes and polypeptides it codes are said are to be collinear. Explain?

A polypeptide on complete hydrolysis gives three amino acids. How many sequences are possible for A polypeptide on complete hydrolysis gives three amino acids. How many sequences are possible for that polypeptide?

How many polypeptide chains are there in 1 Hb molecule?

A polypeptide (Mol. wt = 360 ) formed by glycine (Mol. wt = 75 ) amino acid. How many glycine units are used to form it.