Home
Class 12
BIOLOGY
How many amino acids will be coded by t...

How many amino acids will be coded by the mRNA sequence - 5 C C C U C A G U C A U A C 3' if a adensine residue is inserted after `12^(th)` nucleotide ?

A

Five amino acids

B

Six amino acids

C

Two amino acids

D

Three amino acids

Text Solution

Verified by Experts

The correct Answer is:
C
Promotional Banner

Topper's Solved these Questions

  • MOLECULAR BASIS OF INHERITANCE

    AAKASH INSTITUTE|Exercise ASSIGNMENT (SECTION -C) Previous Years Questions|137 Videos

  • MOLECULAR BASIS OF INHERITANCE

    AAKASH INSTITUTE|Exercise ASSIGNMENT (SECTION -D) (Assertion -Reason Type Questions)|20 Videos

  • MOLECULAR BASIS OF INHERITANCE

    AAKASH INSTITUTE|Exercise ASSIGNMENT (SECTION -A) Objective Type Questions|35 Videos

  • MOCK_TEST_20

    AAKASH INSTITUTE|Exercise EXAMPLE|32 Videos

  • MORPHOLOGY OF FLOWERING PLANTS

    AAKASH INSTITUTE|Exercise TRY YOURSELF|38 Videos

Similar Questions

Explore conceptually related problems

How many amino acids can be coded by the sequence if the 14^(th) base of given mRNA converts to G? 5' AUG UUU CUC UAG CCG 3'

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

How many grams of magnesium will have the same number of atoms as 6 grams of carbon ? (Mg = 24 u , C = 12 u )

Study the given arrangement carefully and answer the question given below: D U B C A B E D C A B U D C B A E D B C A D E B A U C D A E B How many such vowels are there in the above arrangement each of which is immediately preceded by a consonant and also immediately followed by a vowel? 1) One 2) Two 3) Three 4) Four 5) More than four

Study the given arrangement carefully and answer the question given below: D U B C A B E D C A B U D C B A E D B C A D E B A U C D A E B How many meaningful words can be formed with the alphabets which are first, second, fifth, and sixth from the right end of the above arrangement? 1) None 2) One 3) Two 4) Three 5) More than three

Study the given arrangement carefully and answer the question given below: C U B A E D E D A B E B A U C D B C A D B D U B C A C B E D A If all the A's are dropped from the above arrangement, which of the given will be eleventh from the left end of the above arrangement? 1) E 2) C 3) D 4) U 5) None of these

Study the given arrangement carefully and answer the question given below: C U B A E D E D A B E B A U C D B C A D B D U B C A C B E D A How many such vowels are there in the above arrangement each of which is immediately preceded by a vowel and also immediately followed by a consonant? 1) None 2) One 3) Two 4) Three 5) More than three

Study the given arrangement carefully and answer the question given below: C U B A E D E D A B E B A U C D B C A D B D U B C A C B E D A How many meaningful words can be formed with the alphabets which are second, sixth and seventh from the left end of the above arrangement? 1) None 2) One 3) Two 4) Three 5) More than three

How many moles are represented by 100 g of glucose. C_(6)H_(12)O_(6) ? (C = 12 u , H = 1 u , O = 16 u)

AAKASH INSTITUTE-MOLECULAR BASIS OF INHERITANCE -ASSIGNMENT (SECTION -B) Objective Type Questions
  1. In which step of DNA profiling, nitrocellulose membrane is used ?

    Text Solution

    |

  2. Repressor of lac-operon

    Text Solution

    |

  3. Select the correct one (w.r.t. Wobble hypothesis)

    Text Solution

    |

  4. A set of genes or cDNA is immobilized on a glass slide and used in tra...

    Text Solution

    |

  5. Which of the following bases is not present in DNA ?

    Text Solution

    |

  6. If there are 81 million bases in RNA of human cell then calculate the ...

    Text Solution

    |

  7. Splicing is necessary for preparing a mature transcript and its movem...

    Text Solution

    |

  8. Majority of unusual bases are found in tRNA, T psi C loop is

    Text Solution

    |

  9. How many amino acids will be coded by the mRNA sequence - 5 C C C U...

    Text Solution

    |

  10. Identification and binding of RNA polymerase to the promoter sequence...

    Text Solution

    |

  11. Repetitive sequence are stretches of DNA with repeated bases many ti...

    Text Solution

    |

  12. The microsatellites have simple sequence of repeated

    Text Solution

    |

  13. The DNA strand showing replication using Okazaki fragments also show...

    Text Solution

    |

  14. Prokaryotic transcription mechanism requires involvement of only one...

    Text Solution

    |

  15. Pribnow box is consensus of bases forming a binding site for E.coi...

    Text Solution

    |

  16. In tryptophan operon

    Text Solution

    |

  17. In tailing, adenylate residues are added at 3 end

    Text Solution

    |

  18. For every single amino acid incorporated in peptide chain ATP and...

    Text Solution

    |

  19. In t-RNA

    Text Solution

    |

  20. The one aspect which is not a salient feature of genetic code, is its...

    Text Solution

    |