How many amino acids are present in the following polypeptide chain ?

How many amino acids are present in insulin ?

How many amino acids are present in insulin ?

How many types of amino acids are present in protein ?

How many types of amino acids are present in protein ?

Give below is sequence of the processed mRNA ready for translation 5'AUG CUA UAC UAA CUG CCA UGC UAG-3' How many amino acids will present in polypeptide chain corresponding to theis mRNA

Identify the polarity from a to a', in the given diagram and mention how many amino acids are expected to be added to this polypeptide chain.

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?