Which of the following mRRNA will get translated completely ?

Options

A. AUGUUUCCUCAUUAGGGUGUU
B. GUGUUUCCUCAUGGUUGAGUU
C. AUGUUUCCUCAUGGUGUUUAA
D. AUGUUUCCUUGAAGGUUUUA

Answer

To determine which mRNA will be translated completely, we need to analyze the provided options for the presence of stop codons. Stop codons signal the termination of the translation process, meaning that if an mRNA sequence contains a stop codon, translation will stop at that point, and any amino acids coded after that will not be synthesized.

### Step-by-Step Solution:

1. **Understand the Concept of Translation**:
- Translation is the process where the information in mRNA is used to synthesize proteins. Each set of three nucleotides in mRNA, called a codon, corresponds to a specific amino acid.

2. **Identify Stop Codons**:
- There are three stop codons: UAA, UAG, and UGA. When a ribosome encounters any of these codons during translation, it terminates the process.

3. **Analyze Each Option**:
- **Option 1**: AUG, UUU, CCU, CAU, UAG
- Contains UAG (stop codon). Translation stops here after 4 amino acids.
- **Option 2**: GUG, UUU, CCU, CAU, GGU, UAG
- Contains UAG (stop codon). Translation stops here after 5 amino acids.
- **Option 3**: AUG, UUU, CCU, CAU, GGU, GUU, UAA
- Contains UAA (stop codon) at the end. Translation will include all preceding codons, resulting in the synthesis of all 6 amino acids.
- **Option 4**: AUG, UUU, CCU, UGA
- Contains UGA (stop codon). Translation stops here after 3 amino acids.

4. **Determine the Correct Answer**:
- The only option that allows for complete translation of the mRNA sequence is **Option 3**: AUG, UUU, CCU, CAU, GGU, GUU, UAA. The stop codon UAA appears at the end, meaning all preceding codons are translated into amino acids.

### Final Answer:
**Option 3**: AUG, UUU, CCU, CAU, GGU, GUU, UAA will get translated completely.