Home
Class 11
BIOLOGY
If the coding sequence in a transcriptio...

If the coding sequence in a transcription unit is written as follows:
5'TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.

Text Solution

Verified by Experts

Sequence of mRNA for the given coding unit 3. ACGUAACGUAACGUAACGUAACGUAACGUAACG 5.
Promotional Banner

Similar Questions

Explore conceptually related problems

If the sequence of the coding strand in a transcription unit is written as follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3' Write down the sequence of mRNA.

If the sequence of one strand of DNA is written as follows: 5'-ATGCATGCATGCA’TGCATGCATGCATGC-3' Write down the sequence of complementary strand in 5' - 3' direction.

Write an palindrome sequence of DNA.

Coding sequences of mRNA ______

Name the non coding sequences of mRNA ____

The sequence of stages of mitotic cell division is as follows:

Coding sequences found in split genes are called.

Write briefly about S-D sequence.

Non-coding sequences of mRNA ______

Write down the power set of A = {3, {4, 5}}.