An mRNA having 300 Nitrogen bases results in a protein with how many amino acids (A) 100 (B) 300 (C) 299 (D) 99

Proteins are assembled from how many amino acids ?

How many bases code for one amino acid?

How many amino acids are used in protein synthesis?

How many types of amino acids are present in protein ?

How many codons code for amino acids ? (a) 64 (b) 61 (c) 68 (d) 60

There are 125 amino acids. We want to synthesize and mRNA. How many nitrogen bases are required to form sufficient condons to code all 125 amino acids?

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

Out of 64 codons how many codons do not code for any amino acid? (a) 62 (b) 61 (c) 3 (d) 1

How many numbers are there from 100 to 300 ?