Home
Class 12
BIOLOGY
To code the 50 aminoacids in a polypepti...

To code the 50 aminoacids in a polypeptide chain, what will be the minimum number of nucleotides in its cistron?

A

50

B

153

C

306

D

300

Text Solution

AI Generated Solution

The correct Answer is:
To determine the minimum number of nucleotides required in a cistron to code for a polypeptide chain of 50 amino acids, we can follow these steps: ### Step-by-Step Solution: 1. **Understanding Codons**: Each amino acid in a polypeptide is coded by a sequence of three nucleotides, known as a codon. 2. **Calculating Codons for Amino Acids**: To code for 50 amino acids, we need to consider that we also require a stop codon. Therefore, the total number of codons needed is: \[ \text{Total Codons} = \text{Number of Amino Acids} + \text{Stop Codon} = 50 + 1 = 51 \text{ codons} \] 3. **Calculating Nucleotides**: Since each codon consists of 3 nucleotides, the total number of nucleotides required is: \[ \text{Total Nucleotides} = \text{Total Codons} \times 3 = 51 \times 3 = 153 \text{ nucleotides} \] 4. **Considering Cistron Structure**: A cistron refers to a segment of DNA that can code for a protein and is typically double-stranded. Therefore, we must account for both strands of the DNA. Thus, we multiply the number of nucleotides by 2: \[ \text{Minimum Nucleotides in Cistron} = 153 \times 2 = 306 \text{ nucleotides} \] 5. **Final Answer**: The minimum number of nucleotides in the cistron required to code for a polypeptide chain of 50 amino acids is **306**.
Promotional Banner

Similar Questions

Explore conceptually related problems

If molecular weight of a polypeptide is 15.3kDa, what would be the minimum number of nucleotides in the mRNA that codes for this polypeptide ? Assume that molecular weight of each amino acid is 90 Da.

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

A segment of DNA molecule contains 200 guanine and 200 thymine bases. What will be the total number of nucleotides in this segment of DNA ?

If there are 34 amino acids and DNA contains only two nitrogenous bases, what would be the minimum number of bases per codon that code for amino acids?

What should be the minimum number of persons to form a Partnership :

Assume that the occurrence of nitrogen bases in adjacent positions in a DNA strand is random. Identify the minimum number of nucleotides in a DNA strand where GAAT can occur once on the basis of probability