Home
Class 12
BIOLOGY
Give below is sequence of the processed ...

Give below is sequence of the processed mRNA ready for translation 5'AUG CUA UAC UAA CUG CCA UGC UAG-3' How many amino acids will present in polypeptide chain corresponding to theis mRNA

A

7

B

8

C

6

D

3

Text Solution

Verified by Experts

The correct Answer is:
D
Promotional Banner

Similar Questions

Explore conceptually related problems

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

The following sequence contains the open reading frame of a polypeptide. How many amino acids will the polypeptide consists of ? 5' AGCATATGATCGTTTCTCTGCTTTGAACT-3'

Read the following statements. (i) One codon codes for only one amino acid. (ii) Some amino acids are coded by more than one codon. (iii) The sequence of triplet nitrogenous bases in DNA of mRNA coresponds to the amino acid sequence in the polypeptide chain. Give , suitabel terms for the characteristics of 'genetic code' as per the above statements.

AUG GAC CUG AUA UUU UGA is the base sequence in a strand of m-RNA. (i) Write the base sequence of the DNA strand from which it has been transcribed. (ii) Upon translation, how many amino acids will be the resulting peptide have?

If the sequence of the coding strand in a transcription unit is written as follows 5' -ATGCCTAGGTCCAGGCAT-3' Write down the sequence of mRNA. Write down the anticodon for each code and their corresponding amino acids.

How many amino acids can be coded by the sequence if the 14^(th) base of given mRNA converts to G? 5' AUG UUU CUC UAG CCG 3'

(a) Study the table given below and identify (i), (ii), (iii) and (iv) {:("Amino acid","Phe","Val"),("DNA Code in Gene","AAA","CAC"),("Codon in mRNA",(i),(ii)),("Anticodon in tRNA",(iii),(iv)):} (b) A polypeptide consists of 14 different amino acids. (i) How many base pairs must be there in the processed mRNA that codes for this polypeptide? (ii) How many different types of tRNA are needed for the synthesis of this polypeptide ?

How many amino acid can be polymerised by given m-RNA sequence during translation in a bacteria ? 5' AUGUCCACGAUAGACUGAUAA3'