If following is the sequence of nucleotides in mRNA , predict the sequence of amino acids coded by it AUG UUU UUC UUC UUU UUU UUC

Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it: UUUAUGUUCGAGUUAGUGUAA Phe-Met-Phe-Glu-Leu-Val Write the properties of genetic code that can be and that cannot be correlated from the above given data.

The sequence of nucleotides AUG CUU CUC indicates that it is a segment of

A sequence of how many nucleotides in messenger RNA makes a for an amino acid

It is possible to predict sequence of codon on mRNA by studying the sequence of amino acids in a polypeptide chain.

A sequence of how many nucleotides in messenger RNA makes a condon for an amino acid

A sequence of how many nucleotides in messenger RNA makes a codon for an amino acid ?

Identify giving reasons, the salient features of genetic code by studying the following nucleotide sequence of mRNA strand and the polypeptide chain translated from it. AUG UUU UCU UUU UUU UCU UAG Met- Phe- Ser- Phe- Phe- Ser.