Study the mRNA segment given above which is to be translated into a polypeptide chain.
(i) Write the codons 'a' and 'b'
(ii) What do they code for
(iii) How is peptide bond formed between two amino acids in the ribosome?

ltimg src="https://d10lpgp6xz60nq.cloudfront.net/physics_images/SB_BIO_XII_SET_II_2008_E01_026_Q01.png" width="80%"gt Study the mRNA segment given above which is complete to be translated into a polypeptide chain. (i) Write the codons'a' and 'b' (ii) What so they code for ? (iii) How is peptide bond formed between two amino acids in the ribosome ?

Study the mRNA segment given above, which is to be completely translated into a polypeptide chain. The codons for 'a' and 'b' are:

Which of the two groups of the given formula is involved in peptide bond formation between different amino acids ?

Refer to the given mRNA segment It can be translated completely into a polypeptide. Which of the following codons may correspond with A and B ?

The diagrams show the structures of two amino acids, each of which has two amine (-NH_2) Group . A peptide bond is formed between the two amino acids. Which groups could from the peptide bond ?

Two elements X and Y have atomic number 12 and 17 respectively. (i) Write the electronic configuration of both. (ii) Which type of bond will they form ? (iii) Write the formula of the compound formed by their combination (in terms of X and Y).

In the following diagram for the first three periods of the periodic table, five elements have been represented by the letters a,b,c,d and e (which are not their chemical symbols): (i) Select the letter which represents a halogen. (ii) Select the letter which represents a noble gas. (iii) What type of bond is formed between a and b ? (iv) What type of bond is formed between c and b ? (v) Which element will form a divalent anion?

On translation , mRNA produce a polypeptide chain , which contains 50 amino acids. if 26^( th) codon of mRNA UUU mutated and changed to UUC , then the polypeptide chain will be

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?