Given below are the sequence of nucleoti...

Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it:
UUUAUGUUCGAGUUAGUGUAA
Phe-Met-Phe-Glu-Leu-Val
Write the properties of genetic code that can be and that cannot be correlated from the above given data.

Promotional Banner

Promotional Banner

Recommended Questions

Given below are the sequence of nucleotides in a particular mRNA and a...
Text Solution
|
Partial hydrolysis of gamicidin (S) gave the following dipeptides // T...
Text Solution
|
mRNA overset(AUG UUU AUG C CU GUU UCU UA A)to Polypeptide Met-Phe-Me...
Text Solution
|
mRNA overset(AUG UUU AUG C CU GUU UCU UA A)to Polypeptide Met-Phe-Me...
Text Solution
|
Given below are the sequence of nucleotides in a particular mRNA and a...
Text Solution
|
If following is the sequence of nucleotides in mRNA , predict the sequ...
Text Solution
|
नीचे दिये गये mRNA के खण्ड में न्यूक्लियोटाइड के क्रम और क्रमिक पॉलीपे...
Text Solution
|
नीचे दिये गये mRNA के खण्ड में न्यूक्लियोटाइड के क्रम और क्रमिक पॉलीपे...
Text Solution
|
mRNA overset(AUG UUU AUG C CU GUU UCU UA A)to Polypeptide Met-Phe-Met-...
Text Solution
|