To code the 50 aminoacids in a polypeptide chain, what will be the minimum number of nucleotides in its cistron?

If molecular weight of a polypeptide is 15.3kDa, what would be the minimum number of nucleotides in the mRNA that codes for this polypeptide ? Assume that molecular weight of each amino acid is 90 Da.

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

Number of polypeptide chains present in a molecule of antibody :

Insulin consists of 2 polypeptide chains, such as chain A and chain B. Write the number of amino acid in each chain.