Home
Class 12
BIOLOGY
The given nucleotide sequence on mRNA is...

The given nucleotide sequence on mRNA is as shown below :
5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3'
(A) How many amino acids will be inserted in a polypeptide chain under normal conditions?
(B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

Promotional Banner

Similar Questions

Explore conceptually related problems

How many amino acids are present in the following polypeptide chain ?

How many amino acids and polypeptide chains are present in insulin?

How many amino acids are arranged in the two chains of Insulin?

How many amino acids are arranged in the two chains of Insulin ?

How many amino acids are there in the alpha chain of haemoglobin?

How many amino acids are arranged in tow chains of insullin?

Give below is sequence of the processed mRNA ready for translation 5'AUG CUA UAC UAA CUG CCA UGC UAG-3' How many amino acids will present in polypeptide chain corresponding to theis mRNA

How many amino acids are arranged in two chains of insulin?