Would an oligopeptide result from m-RNA seqnece given below? How many amino acids would be in it?
5'UGGCCCAUGCACAGGUAGACCTAG3'

Proteins are assembled from how many amino acids ?

How many decimal places would (0.3)^3 have?

How many amino acid can be polymerised by given m-RNA sequence during translation in a bacteria ? 5' AUGUCCACGAUAGACUGAUAA3'

The following sequence contains the open reading frame of a polypeptide. How many amino acids will the polypeptide consists of ? 5' AGCATATGATCGTTTCTCTGCTTTGAACT-3'

A sequence of how many nucleotides in messenger RNA makes a for an amino acid

A sequence of how many nucleotides in messenger RNA makes a codon for an amino acid ?