`mRNA overset(AUG UUU AUG C CU GUU UCU UA A)to`
Polypeptide Met-Phe-Met-Pro-Val-Ser
Which codons respectively code for proline and valine amino acids in the given polypeptide chain, respectively ?

mRNA overset(AUG UUU AUG C CU GUU UCU UA A)to Polypeptide Met-Phe-Met-Pro-Val-Ser Nucleotide sequence of the DNA strand from which this mRNA was transcribed is

mRNA overset(AUG UUU AUG C CU GUU UCU UA A)to Polypeptide Met-Phe-Met-Pro-Val-Ser Nucleotide sequence of the DNA strand from which this mRNA was transcribed is

On translation , mRNA produce a polypeptide chain , which contains 50 amino acids. if 26^( th) codon of mRNA UUU mutated and changed to UUC , then the polypeptide chain will be

On translation , mRNA produce a polypeptide chain , which contains 50 amino acids. if 26^( th) codon of mRNA UUU mutated and changed to UUC , then the polypeptide chain will be

Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it: UUUAUGUUCGAGUUAGUGUAA Phe-Met-Phe-Glu-Leu-Val Write the properties of genetic code that can be and that cannot be correlated from the above given data.

The following features occur during protein synthesis: (a) Movement of mRNA from the nucleus into the cytoplasm, where it binds to the ribosomes (b) Formation of tRNA-amino acid complex (c) Transcription of specific segments of DNA into mRNA molecules in the nucleus (d) Binding of N-terminal amino acid, methionine tRNA to the 'P' site of the ribosome. The tRNA anticodon 'pairs with AUG on mRNA' (e) Formation of peptide bond between first and second amino acids at the A site (f) Release of the complete polypeptide chain from mRNA and the ribosomes (g) Migration of dipeptide to form a tripeptide and then a polypeptide The correct order of events is: