Study the mRNA segment given above which is complete to be translated into a polypeptide chain.
(i) Write the codons'a' and 'b'
(ii) What so they code for ?
(iii) How is peptide bond formed between two amino acids in the ribosome ?

Which of the two groups of the given formula is involved in peptide bond formation between different amino acids ?

Refer to the given mRNA segment It can be translated completely into a polypeptide. Which of the following codons may correspond with A and B ?

The diagrams show the structures of two amino acids, each of which has two amine (-NH_2) Group . A peptide bond is formed between the two amino acids. Which groups could from the peptide bond ?

(i) Study the above table and fill in the blanks. (ii) What is the relationship between C and D elements ? (iii) Define the term stated in (ii). (iv) Write the formula of compound formed between D and B.

From the following, the statement /s that will help to determine the specificity of an enzyme is /are: I. The bonding between R groups of amino acids of the polypeptide II. The optimum pH of the enzyme III. The peptide bonds between amino acids of the polypeptide IV. The shape of the substrate molecule

(a) In the formation of compound between two atoms A and B, A loses two electrons and B gains one electron. (i) What is the nature of bond between A and B? (ii) Suggest the formula of the compound formed between A and B. (b) On similar lines explain the formation of MgCl_(2) molecule. (c ) Common salt conducts electricity only in the molten state. Why? (d) Why is melting point of NaCl high ?

On translation , mRNA produce a polypeptide chain , which contains 50 amino acids. if 26^( th) codon of mRNA UUU mutated and changed to UUC , then the polypeptide chain will be

Select an option that shows the correct sequence of the events involved in the translation mechanism. a. Binding of mRNA to smaller subunit of ribosome b. Aminoacylation of tRNA c. Binding of initiator tRNA to the P-site of the ribosome d. Formation of polypeptide e. Formation of peptide bond between first and second amino acids at the A site.

Read the following statements. (i) One codon codes for only one amino acid. (ii) Some amino acids are coded by more than one codon. (iii) The sequence of triplet nitrogenous bases in DNA of mRNA coresponds to the amino acid sequence in the polypeptide chain. Give , suitabel terms for the characteristics of 'genetic code' as per the above statements.

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?