Home
Class 12
BIOLOGY
How many amino acids can be coded by the...

How many amino acids can be coded by the sequence if the `14^(th) ` base of given mRNA converts to G? 5' AUG UUU CUC UAG CCG 3'

A

four

B

two

C

three

D

five

Text Solution

AI Generated Solution

Promotional Banner

Topper's Solved these Questions

Similar Questions

Explore conceptually related problems

How many amino acid can be polymerised by given m-RNA sequence during translation in a bacteria ? 5' AUGUCCACGAUAGACUGAUAA3'

What is amino acid sequence encoded by base sequence UCA UUU UCC GGG AGU of mRNA segment ?

How many amino acids will be coded by following given or more than one cytosine represent the intron? AUG CCC CAC CAC UUA UAU AUA GGC GAC AAA GCG UUU CAU UAA

A polypeptide of 600 amino acids will be coded for by a linear-sequence of how many bases in (a) mRNA and (b) DNA?

How many amino acids will be coded by the mRNA sequence - 5 C C C U C A G U C A U A C 3' if a adensine residue is inserted after 12^(th) nucleotide ?

Read the following statements. (i) One codon codes for only one amino acid. (ii) Some amino acids are coded by more than one codon. (iii) The sequence of triplet nitrogenous bases in DNA of mRNA coresponds to the amino acid sequence in the polypeptide chain. Give , suitabel terms for the characteristics of 'genetic code' as per the above statements.

Identify the sequence of mRNA from the given sequence of coding strand of DNA. 5' T A C G T A G 3'

Whate would be the corrcct base sequence in mRNA for the given DNA strand 5' -AAATGCCTTAAGC- 3'

How many bases code for one amino acid?

AAKASH INSTITUTE-TEST 6-EXAMPLE
  1. Translocation factor in bacteria during translation is

    Text Solution

    |

  2. Transcription and translation can be coupled in bacteria because

    Text Solution

    |

  3. How many amino acids can be coded by the sequence if the 14^(th) bas...

    Text Solution

    |

  4. The triplet nature of genetic code was suggested by

    Text Solution

    |

  5. RNA polymerase III can catalyse the synthesis of all, except

    Text Solution

    |

  6. The DNA sequence that provides binding site for RNA polymerase in euka...

    Text Solution

    |

  7. DNA is preferred for storage of genetic information because it

    Text Solution

    |

  8. One codon codes for only one amino acid. This is called (a) natu...

    Text Solution

    |

  9. The process which represents dominance of RNA world is

    Text Solution

    |

  10. Select the mismatched pair

    Text Solution

    |

  11. Complete the following statement. Widal test in A of man suggest the i...

    Text Solution

    |

  12. Ronald Ross is assosiated with discovery of

    Text Solution

    |

  13. Oparin's coacervates fail to fulfill the requirement as a candidate of...

    Text Solution

    |

  14. Sting of honey bee and scorpion exemplify

    Text Solution

    |

  15. All of the following are examples of atavism in humans except

    Text Solution

    |

  16. Dinosaursad toothed birds became extinct in

    Text Solution

    |

  17. Name the first one-toed horse.

    Text Solution

    |

  18. Which of the following is an incorrect match w.r.t. theory and its pr...

    Text Solution

    |

  19. Which one the following factors does not affect the Hardy-Weinberg law...

    Text Solution

    |

  20. Industrial melanism is one of the most striking example which demonstr...

    Text Solution

    |