Home
Class 12
BIOLOGY
Many times the translation can begin muc...

Many times the translation can begin much before the mRNA is fully transcribed in

A

Chlorella and Drosophila

B

Chlorodium and Rhizobium

C

Chlamydomonas and Neurospora

D

Garden pea and pink mould

Text Solution

AI Generated Solution

Promotional Banner

Topper's Solved these Questions

Similar Questions

Explore conceptually related problems

Assertion : The transcription and traslation can be coupled in bacteria. Reason : In bacteria transcription and translation take place in the same compartment and also the mRNA does not require any processing to become active

At which end of mRNA translation always begins?

Find the sequence of blinding of the following amono acyl-tRNA complexes during translation of an mRNA transcribed by DNA segment having the base sequence 3' TACATGGGTCCG 5'. Choose the answer showing the correct order of alphabets.

Find the sequence of binding of the following amino acyltRNA complexes during translation to a mRNA transcribed by a DNA segment having the base seqeucne 3' TACATGGGTCCG5' Choose the right answer in which the correct order of alphabets is showing

How many amino acid can be polymerised by given m-RNA sequence during translation in a bacteria ? 5' AUGUCCACGAUAGACUGAUAA3'

A boy increases his speed to (9)/(5) times of his original speed .By doing this ,he reaches his school 40 minutes before the usual time .How much time (in minutes )does he take usually ?

AAKASH INSTITUTE-TEST 6-EXAMPLE
  1. Select the incorrect statement

    Text Solution

    |

  2. Match Column - I with Column - II,(a) UGG(Column I),(i)Termination cod...

    Text Solution

    |

  3. Many times the translation can begin much before the mRNA is fully tra...

    Text Solution

    |

  4. An unusual nucleotide is present in a.23S rRNA,b. 18S rRNA,c.t-RNA,d.m...

    Text Solution

    |

  5. Select the incorrect statement w.r.t. HGP

    Text Solution

    |

  6. Consider the following statements regarding DNA fingerprint. a)The tec...

    Text Solution

    |

  7. Select the mis-match w.r.t. the functions of RNA polymerases in eukary...

    Text Solution

    |

  8. Polymorphism in DNA sequences

    Text Solution

    |

  9. Classical plant breeding involves

    Text Solution

    |

  10. The entire collection of plants or seeds having all the driverse allel...

    Text Solution

    |

  11. Select the odd-one out w.r.t. causative agents of following disesases.

    Text Solution

    |

  12. Resistance to yellow mosaic virus in Abelmoschus esculentus was transf...

    Text Solution

    |

  13. High aspartic acid,low nitrogen and sugar content in maize leads to re...

    Text Solution

    |

  14. Select the incorrect statement w.r.t.Atlas 66.

    Text Solution

    |

  15. Find the mis match

    Text Solution

    |

  16. Select the incorrect statement w.r.t somatic hybridisation

    Text Solution

    |

  17. The cheese which is repened by growing a specific fungi penicillium on...

    Text Solution

    |

  18. The unopened spadices of palm Caryota urens are tapped and the sap is ...

    Text Solution

    |

  19. Select the mis match

    Text Solution

    |

  20. Consider the following statement, A- Major component of biogas is meth...

    Text Solution

    |