Home
Class 12
BIOLOGY
Would an oligopeptide result from m-RNA ...

Would an oligopeptide result from m-RNA seqnece given below? How many amino acids would be in it?
5'UGGCCCAUGCACAGGUAGACCTAG3'

A

No

B

Yes, 8 amino acids

C

yes, 4 amino acids

D

yes, 3 amino acids

Text Solution

AI Generated Solution

The correct Answer is:
To determine whether an oligopeptide would result from the given mRNA sequence and how many amino acids it would contain, we can follow these steps: ### Step-by-Step Solution: 1. **Identify the mRNA Sequence**: The given mRNA sequence is: ``` 5' - UGGCCCAUGCACAGGUAGACCTAG - 3' ``` 2. **Locate the Start Codon**: The start codon for translation is typically "AUG". In the given sequence, we can find "AUG" at the following position: ``` UGGCCCAUG ``` Here, "AUG" is the start codon. 3. **Locate the Stop Codon**: The stop codons are "UAA", "UAG", and "UGA". In the given sequence, we can see "UAG": ``` ...GUAG... ``` Here, "UAG" is the stop codon. 4. **Identify Codons Between Start and Stop Codons**: The codons that will be translated into amino acids are those between the start codon "AUG" and the stop codon "UAG". The relevant codons are: - AUG (1st codon) - CAC (2nd codon) - CAG (3rd codon) 5. **Count the Amino Acids**: Each codon corresponds to one amino acid. Therefore, we have: - AUG → 1 amino acid - CAC → 1 amino acid - CAG → 1 amino acid This gives us a total of 3 amino acids. 6. **Conclusion**: An oligopeptide would result from the given mRNA sequence, and it would contain 3 amino acids. ### Final Answer: Yes, an oligopeptide would result from the mRNA sequence, and it would contain **3 amino acids**. ---
Promotional Banner

Topper's Solved these Questions

  • MINERAL NUTRITION

    TRUEMEN BIOLOGY ENGLISH|Exercise MULTIPLE CHOICE QUESTIONS|387 Videos
  • Monera

    TRUEMEN BIOLOGY ENGLISH|Exercise ASSERTION AND REASON|14 Videos

Similar Questions

Explore conceptually related problems

From the given below processes how many are associated with post-fertilisation event ?

Among the oxides gives below, how many are acidic ? CrO_3, Mn_2 O_7, CO, SO_2 .

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

Starting from carbon dioxide how would you obtain A weak acid

The magnitude of resultant vectors of two vectors given by vecA = 10hati+15hatj and vecB = 5hati would be

Choosing the substances from the list given below, write balanced chemical equations for the reactions which would be used in the laboratory to obtain the following salts: Zinc carbonate

Choosing the substances from the list given below, write balanced chemical equations for the reactions which would be used in the laboratory to obtain the following salts: Sodium sulphate

How would you prepare propane from butanoic acid?

Two boys can paint a fence in 5 hours. How many hours would it take 3 boys to paint the same fence?

Identify the polarity from a to a', in the given diagram and mention how many amino acids are expected to be added to this polypeptide chain.

TRUEMEN BIOLOGY ENGLISH-MOLECULAR BASIS OF INHERITANCE-MCQs
  1. A DNA molecule having A+G//C+T=0.71 shows that the molecule is:

    Text Solution

    |

  2. On a planet from a distant galaxy, the pilot vehicle collected a sampl...

    Text Solution

    |

  3. Would an oligopeptide result from m-RNA seqnece given below? How many ...

    Text Solution

    |

  4. During electrolphoresis, DNA fragment would migrate

    Text Solution

    |

  5. A base pair change:

    Text Solution

    |

  6. Which of the following is true about a viriod

    Text Solution

    |

  7. Read the description given below:- 1. They are nucleic acids 2. Th...

    Text Solution

    |

  8. In a charged transfer RNA, the nucleotide bound to the amino acid is a...

    Text Solution

    |

  9. The technique used for analysis of RNA is called

    Text Solution

    |

  10. Which of the following statements is not true for retroviruses?

    Text Solution

    |

  11. E. coli cells with a mutated z gene of the lac operon cannot grow in m...

    Text Solution

    |

  12. Telomerase is an enzyme which is a

    Text Solution

    |

  13. Which one of the following correctly represents the manner of replicat...

    Text Solution

    |

  14. Which of the following is not true for operon concept of jacobe and mo...

    Text Solution

    |

  15. A regularity gene produces some kind of protein through its m-RNA that...

    Text Solution

    |

  16. How many high-energy phosphate bond equivalents are utilized in the pr...

    Text Solution

    |

  17. Given a hypothetical segment of functional DNA strand 3'-GGC AAC CTT G...

    Text Solution

    |

  18. Consider the following events in DNA replication 1. Formation of RNA...

    Text Solution

    |

  19. Which of the following statements are true of all t-RNAs? 1. The 5'e...

    Text Solution

    |

  20. Consider the following processes 1. Synthesis of t-RNA 2. Attachme...

    Text Solution

    |