What is a transcription unit in DNA?

What is transcription?

Which one of the following is not a part of a transcription unitinDNA?

What is reverse transcription?

If the sequence of the coding strand in a transcription unit is written as follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3' Write down the sequence of mRNA.

Which is NOT a part of transcription unit?

Give a detailed account of a transcription unit.

If the coding sequence in a transcription unit is written as follows: 5'TGCATGCATGCATGCATGCATGCATGC 3' Write down the sequence of mRNA.

The enzyme that catalyses transcription of RNA in bacteria:

What is DNA repair.

Give one word for the following. a. Genes that are constantly requires for cellular activities. b. Sequences of nitrogen bases in mRNA containing the information for protein synthesis. c. Transcription of DNA from RNA d. A segment of DNA e. Synthesis of DNA from pre-existing DNA. f. Small genetic unit that can mutate