Home
Class 12
BIOLOGY
Whate would happen if in a gene encoding...

Whate would happen if in a gene encoding a polypeptide of 50 amino acids , `25^(th)` codon (UAU) is mutated to UAA

A

A polypeptide of 25 amino acids will be formed

B

Two polypeptides of 24 and 25 amino acids will be formed

C

A polypeptide of 49 amino acids will be formed

D

A polypeptide of 25 amino acids will be formed

Text Solution

Verified by Experts

The correct Answer is:
A
Promotional Banner

Similar Questions

Explore conceptually related problems

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25^(th) codon (UAU) is mutated to UA A?

In a polypeptide chain of 125 amino acids, if the 25^(th) amino acid is mutated to UAA, then :-

A gene encoding for a polypeptide of 60 amino acids get mutated at 30^(th) codon UAU becoming UAA The result would be

On translation , mRNA produce a polypeptide chain , which contains 50 amino acids. if 26^( th) codon of mRNA UUU mutated and changed to UUC , then the polypeptide chain will be

What would happen if histones were to be mutated and made rich in acidic amino acids such as aspertic acid and gultamic acid in place of basic amino acids such as lysine and arginine?

What would happen if histones were to be mutated and made rich in acidic amino acids such as aspertic acid and gultamic acid in place of basic amino acids such as lysine and arginine?

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

Study the mRNA segment given above which is complete to be translated into a polypeptide chain. (i) Write the codons'a' and 'b' (ii) What so they code for ? (iii) How is peptide bond formed between two amino acids in the ribosome ?

How many coded nitrogen bases are present in m-RNA from which a polypeptide chain with 60 amino acids is formed in bacteria cells, (including nonsense codon)?