Home
Class 12
BIOLOGY
How many amino acids will be coded by t...

How many amino acids will be coded by the mRNA sequence - 5 C C C U C A U A G U C A U A C 3' if a adenosine residue is inserted after `12^(th)` nucleotide ?

A

Five amino acids

B

Six amino acids

C

Two amino acids

D

Three amino acids

Text Solution

AI Generated Solution

The correct Answer is:
To determine how many amino acids will be coded by the mRNA sequence 5' C C C U C A U A G U C A U A C 3' after inserting an adenosine residue after the 12th nucleotide, we can follow these steps: ### Step-by-Step Solution: 1. **Identify the Original mRNA Sequence**: The original mRNA sequence is 5' C C C U C A U A G U C A U A C 3'. 2. **Count the Nucleotides**: Count the nucleotides in the sequence. The sequence has 24 nucleotides. 3. **Insert the Adenosine Residue**: Insert an adenosine (A) after the 12th nucleotide. The sequence will now look like this: 5' C C C U C A U A A G U C A U A C 3'. 4. **Divide the Sequence into Codons**: Codons are groups of three nucleotides. After the insertion, the sequence can be divided as follows: - 1st Codon: C C C - 2nd Codon: U C A - 3rd Codon: U A G - 4th Codon: U C A - 5th Codon: U A C 5. **Identify the Codons and Their Corresponding Amino Acids**: Using the genetic code: - C C C codes for Proline (Pro) - U C A codes for Serine (Ser) - U A G is a stop codon (does not code for any amino acid) - U C A codes for Serine (Ser) - U A C codes for Tyrosine (Tyr) 6. **Determine the Number of Amino Acids**: The translation will stop at the first stop codon (U A G). Thus, only the first two codons (C C C and U C A) will be translated into amino acids. 7. **Conclusion**: Therefore, the total number of amino acids coded by the modified mRNA sequence is **2**. ### Final Answer: **2 amino acids will be coded by the mRNA sequence after the insertion of the adenosine residue.**
Promotional Banner

Topper's Solved these Questions

  • MOLECULAR BASIS OF INHERITANCE

    AAKASH INSTITUTE ENGLISH|Exercise ASSIGNMENT (SECTION -C) Previous Years Questions|139 Videos
  • MOLECULAR BASIS OF INHERITANCE

    AAKASH INSTITUTE ENGLISH|Exercise ASSIGNMENT (SECTION -D) (Assertion -Reason Type Questions)|20 Videos
  • MOLECULAR BASIS OF INHERITANCE

    AAKASH INSTITUTE ENGLISH|Exercise ASSIGNMENT (SECTION -A) Objective Type Questions|35 Videos
  • MOCK_TEST_20

    AAKASH INSTITUTE ENGLISH|Exercise EXAMPLE|31 Videos
  • MORPHOLOGY OF FLOWERING PLANTS

    AAKASH INSTITUTE ENGLISH|Exercise TRY YOURSELF|38 Videos

Similar Questions

Explore conceptually related problems

How many amino acids can be coded by the sequence if the 14^(th) base of given mRNA converts to G? 5' AUG UUU CUC UAG CCG 3'

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

Identify the sequence of mRNA from the given sequence of coding strand of DNA. 5' T A C G T A G 3'

What would be the base sequence of RNA transcript obtained from the given DNA segment ? 5' - G C A T T C G G C T A G T A A C-3 Coding strand of DNA 3' - C G T A A G C C G A T C A T C A T T G-5' Non - coding strand of DNA

How many words can be formed with the letters of the word 'LUCKNOW' in which L,U,C occupy odd positions?

In triangle A B C ,l e tR=c i r c u m r a d i u s ,r= i n r a d i u sdot If r is the distance between the circumcenter and the incenter, the ratio R/r is equal to (a) sqrt(2)-1 (b) sqrt(3)-1 (c) sqrt(2)+1 (d) sqrt(3)+1

If the sequence of coding strand in a transcription units is written as follows: 5 - C G T A T C G A T C G G T T C G A -3 Write down the sequence of complementary stand in 3 to 5 direction.

Find the area of the shaded region in Figure, if A C=24\ c m , B C=10\ c m and O is the centre of the circle. (U s e\ \ pi=3. 14)

Find number of oxygen atoms present in 100 mg of CaCO_3. (Atomic mass of Ca = 40 u, C = 12 u, O = 16 u)

The U - shaped and C - shaped structures are

AAKASH INSTITUTE ENGLISH-MOLECULAR BASIS OF INHERITANCE -ASSIGNMENT (SECTION -B) Objective Type Questions
  1. In which step of DNA profiling, nitrocellulose membrane is used ?

    Text Solution

    |

  2. Repressor of lac-operon

    Text Solution

    |

  3. Select the correct one (w.r.t. Wobble hypothesis)

    Text Solution

    |

  4. A set of genes or cDNA is immobilized on a glass slide and used in tra...

    Text Solution

    |

  5. Which of the following bond is not present in DNA ?

    Text Solution

    |

  6. If there are 81 million bases in RNA of human cell then calculate the ...

    Text Solution

    |

  7. Splicing is necessary for preparing a mature transcript and its movem...

    Text Solution

    |

  8. Majority of unusual bases are found in tRNA, T psi C loop is

    Text Solution

    |

  9. How many amino acids will be coded by the mRNA sequence - 5 C C C U...

    Text Solution

    |

  10. Identification and binding of RNA polymerase to the promoter sequence...

    Text Solution

    |

  11. Repetitive sequence are stretches of DNA with repeated bases many ti...

    Text Solution

    |

  12. The microsatellites have simple sequence of repeated

    Text Solution

    |

  13. The DNA strand showing replication using Okazaki fragments also show...

    Text Solution

    |

  14. Prokaryotic transcription mechanism requires involvement of only one...

    Text Solution

    |

  15. Pribnow box is consensue of bases forming a binding site for E.coi...

    Text Solution

    |

  16. In tryptophan operon

    Text Solution

    |

  17. In tailing, adenylate residues are added at 3 end

    Text Solution

    |

  18. For every single amino acid incorporated in peptide chain ATP and...

    Text Solution

    |

  19. In t-RNA

    Text Solution

    |

  20. The one aspect which is not a salient feature of genetic code, is its...

    Text Solution

    |