Home
Class 12
BIOLOGY
How many among the given amino are essen...

How many among the given amino are essential and must be obtained from food?
Phenylalanine
Valine
Leucine
Glycine
Isoleucine
Threonine
Aspartic acid
(a) 4
(b) 5
(c) 6
(d) 7

A

4

B

5

C

6

D

7

Text Solution

AI Generated Solution

The correct Answer is:
To determine how many of the given amino acids are essential and must be obtained from food, we can follow these steps: ### Step 1: Understand the Concept of Essential Amino Acids Essential amino acids are those that cannot be synthesized by the body and must be obtained from the diet. There are a total of 20 amino acids, out of which 9 are classified as essential. ### Step 2: List the Given Amino Acids The amino acids provided in the question are: - Phenylalanine - Valine - Leucine - Glycine - Isoleucine - Threonine - Aspartic acid ### Step 3: Identify Which of These Amino Acids are Essential From the list of essential amino acids, we know they include: 1. Phenylalanine 2. Valine 3. Leucine 4. Isoleucine 5. Threonine 6. Lysine 7. Methionine 8. Histidine 9. Tryptophan Now, we will check each of the given amino acids against this list: - **Phenylalanine**: Essential - **Valine**: Essential - **Leucine**: Essential - **Glycine**: Not essential (it is a non-essential amino acid) - **Isoleucine**: Essential - **Threonine**: Essential - **Aspartic acid**: Not essential (it is a non-essential amino acid) ### Step 4: Count the Essential Amino Acids From the analysis, we find the following essential amino acids from the given list: 1. Phenylalanine 2. Valine 3. Leucine 4. Isoleucine 5. Threonine This gives us a total of **5 essential amino acids**. ### Conclusion The answer to the question is **(b) 5**. ---
Promotional Banner

Topper's Solved these Questions

  • MINERAL NUTRITION

    AAKASH INSTITUTE ENGLISH|Exercise ASSIGNMENT (SECTION D)|10 Videos
  • Mock Test 06 Zoology

    AAKASH INSTITUTE ENGLISH|Exercise EXAMPLE|15 Videos

Similar Questions

Explore conceptually related problems

One of the following is a neutral amino acid (a) Arginine (b) Glycine (c) Glutamic acid (d) Aspartic acid

The number of essential amino acids among the following is .......... Histidine, Glycine, valine , Alanine, Aspartic acid, Lysine, methionine.

How many different tripeptides can be obtained from alanine, glycine and phenylalanine, each tripeptide containing all the three amino acids?

The distance of the point P(4,\ 3) from the origin is (a) 4 (b) 3 (c) 5 (d) 7

How many chloride ions are there around sodium ion in sodium chloride crystal? (a) 4 (b) 8 (c) 6 (d) 12

How many types of corolla are there in petals? (a) 5 (b) 10 (c) 7 (d) 8

How many molecules of NADH are left at the end of anaerobic respiration (a) 2 (b) 4 (c) 6 (d) 0

How many numbers divisible by 5 and lying between 4000 and 5000 can be formed from the digits 4, 5, 6, 7 and 8.

A sequence of how many nucleotides in messenger RNA makes a codon for amino acid ? (a)Three (b)Four (c)One (d)Two

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

AAKASH INSTITUTE ENGLISH-Mock Test 03-EXAMPLE
  1. Which derived monosaccharide is component of bacterial cell wall?

    Text Solution

    |

  2. Which of the following is a heteropolysaccharide?

    Text Solution

    |

  3. Which of the following is not a storage polysaccharide?

    Text Solution

    |

  4. In which of the following , cellulose content is maximum?

    Text Solution

    |

  5. Which of the following is the most abundant carbohydrate in Biosphere?

    Text Solution

    |

  6. In which of the following amino acids, R-group contains sulphur?

    Text Solution

    |

  7. Which of the following is incorrect match between amino acid and its n...

    Text Solution

    |

  8. How many amino acids (A) and peptide bonds (B) are present in a tetrap...

    Text Solution

    |

  9. How many among the given amino are essential and must be obtained from...

    Text Solution

    |

  10. Which of the following amino acids is precursor of thyroxine, adrenali...

    Text Solution

    |

  11. In primary structure of a protein, methionine is located at left end o...

    Text Solution

    |

  12. Which among the following is not an example of secondary structure of ...

    Text Solution

    |

  13. Which of the following is the correct match between the protein and it...

    Text Solution

    |

  14. Which of the following bond is common to all structures of proteins?

    Text Solution

    |

  15. Which of the following is 18-C unsaturated fatty acid with two double ...

    Text Solution

    |

  16. Which of the following is an incorrect statement regarding Lipids?

    Text Solution

    |

  17. Which of the following is not a components of Lecithin?

    Text Solution

    |

  18. Statement A : Stroids do not contain fatty acids, but are included in ...

    Text Solution

    |

  19. Lanolin is an

    Text Solution

    |

  20. Which of the following is the monomer of Terpenes?

    Text Solution

    |