Home
Class 12
BIOLOGY
The given nucleotide sequence on mRNA is...

The given nucleotide sequence on mRNA is as shown below :
5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3'
(A) How many amino acids will be inserted in a polypeptide chain under normal conditions?
(B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

A

(A) 4, (B) 9

B

(A) 4, (B) 7

C

(A) 6, (B) 8

D

(A) 5, (B) 7

Text Solution

Verified by Experts

The correct Answer is:
B
Promotional Banner

Similar Questions

Explore conceptually related problems

Given below is the sequence of processed mRNA ready for translation: 5-AUG CUA UAC CCU CUU UAU CUG AGA-3' How many amino acid residues will make the up polypeptide corresponding to this mRNA?

A: Polypeptide sequence are dictated by DNA and represented by mRNA. R: Sequence of amino acids in a polypeptide can be predicted by the exact sequence of nucleotides on the mRNA and template DNA.

In a polypeptide chain of 125 amino acids, if the 25^(th) amino acid is mutated to UAA, then :-

Identify the polarity from a to a', in the given diagram and mention how many amino acids are expected to be added to this polypeptide chain.

A prokaryote gene of 600 nucleotides long can code for a polypeptide chain of about, how many amino acids ?

How many coded nitrogen bases are present in m-RNA from which a polypeptide chain with 60 amino acids is formed in bacteria cells, (including nonsense codon)?

On translation , mRNA produce a polypeptide chain , which contains 50 amino acids. if 26^( th) codon of mRNA UUU mutated and changed to UUC , then the polypeptide chain will be

How many amino acids (A) and peptide bonds (B) are present in a tetrapeptide? (a) 4 - 4 (b) 3 - 4 (c) 4 - 3 (d) 3 - 3

How many amino acids will be coded by the mRNA sequence - 5 C C C U C A U A G U C A U A C 3' if a adenosine residue is inserted after 12^(th) nucleotide ?

Study the mRNA segment given above which is complete to be translated into a polypeptide chain. (i) Write the codons'a' and 'b' (ii) What so they code for ? (iii) How is peptide bond formed between two amino acids in the ribosome ?