Home
Class 12
BIOLOGY
A gene encoding for a polypeptide of 60 ...

A gene encoding for a polypeptide of 60 amino acids get mutated at `30^(th)` codon UAU becoming UAA The result would be

A

A polypeptide of 29 amino acids

B

Two polypeptides one with 29 amino acids and second with 31 amino acids.

C

A polypeptide with 59 amino acids.

D

A polypeptide of 25 amino acids.

Text Solution

AI Generated Solution

The correct Answer is:
To solve the question regarding the mutation of a gene encoding a polypeptide of 60 amino acids, we need to analyze the effect of the mutation on the polypeptide chain. ### Step-by-Step Solution: 1. **Identify the Original Codon**: - The original codon at the 30th position is UAU, which codes for the amino acid Tyrosine (Tyr). 2. **Identify the Mutated Codon**: - The mutated codon is UAA. UAA is one of the three stop codons (the others being UAG and UGA) that signal the termination of protein synthesis. 3. **Effect of the Mutation**: - Since UAA is a stop codon, the translation process will terminate at this point. This means that the polypeptide synthesis will stop prematurely. 4. **Determine the Length of the Resulting Polypeptide**: - The original polypeptide was supposed to be 60 amino acids long. However, due to the mutation at the 30th codon, the translation will stop before reaching the 60th amino acid. - The polypeptide will consist of the first 29 amino acids (from the 1st to the 29th codon) and will not include the 30th amino acid or any subsequent amino acids. 5. **Conclusion**: - The resulting polypeptide will be 29 amino acids long. ### Final Answer: The result of the mutation will be a polypeptide of 29 amino acids.
Promotional Banner

Similar Questions

Explore conceptually related problems

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25^(th) codon (UAU) is mutated to UA A?

In a polypeptide chain of 125 amino acids, if the 25^(th) amino acid is mutated to UAA, then :-

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

Polypeptide chain in eukaryotes is initiated by codons coding for amino acid

If there are 99 bases in an mRNA that codes for a protein with 33 amino acids and the base at position 30 undergo nonsense mutation , then what will be the length of polypeptide formed ?

On translation , mRNA produce a polypeptide chain , which contains 50 amino acids. if 26^( th) codon of mRNA UUU mutated and changed to UUC , then the polypeptide chain will be

Assertion: An amino acid in polypeptide chain is not altered due to change in third base of codon. Reason: It is due to Wobble hypothesis

How many coded nitrogen bases are present in m-RNA from which a polypeptide chain with 60 amino acids is formed in bacteria cells, (including nonsense codon)?

Read the following statements. (i) One codon codes for only one amino acid. (ii) Some amino acids are coded by more than one codon. (iii) The sequence of triplet nitrogenous bases in DNA of mRNA coresponds to the amino acid sequence in the polypeptide chain. Give , suitabel terms for the characteristics of 'genetic code' as per the above statements.