Home
Class 12
BIOLOGY
The genetic instructions for forming a p...

The genetic instructions for forming a polypeptide chain are carried to the ribosomes by the

A

tRNA

B

mRNA

C

rRNA

D

DNA

Text Solution

AI Generated Solution

The correct Answer is:
To solve the question, "The genetic instructions for forming a polypeptide chain are carried to the ribosomes by the," we will analyze the options provided and identify the correct answer step by step. ### Step 1: Understand the Role of Each Molecule - **tRNA (Transfer RNA)**: tRNA is responsible for carrying amino acids to the ribosome during protein synthesis. However, it does not carry the genetic instructions; it helps in translating those instructions into a polypeptide chain. - **mRNA (Messenger RNA)**: mRNA is synthesized from DNA and carries the genetic code from the nucleus to the ribosomes. It contains the instructions required for the synthesis of proteins (polypeptides). - **rRNA (Ribosomal RNA)**: rRNA is a component of ribosomes and plays a structural role in the ribosome, facilitating the process of translation but does not carry genetic instructions. - **DNA (Deoxyribonucleic Acid)**: DNA contains the genetic blueprint for an organism but is not directly involved in the transport of instructions to the ribosomes. ### Step 2: Identify the Correct Answer From the analysis: - tRNA carries amino acids, not genetic instructions. - rRNA forms part of the ribosome structure. - DNA holds the genetic information but does not transport it to the ribosomes. The molecule that carries the genetic instructions for forming a polypeptide chain to the ribosomes is **mRNA**. ### Conclusion The correct answer is **mRNA**.
Promotional Banner

Similar Questions

Explore conceptually related problems

A new amino acid in a polypeptide chain is added at

In fibrous proteins, polypeptide chains are held together by........ .

Two polypeptide chains are joined by hydrogen bonds to produce

In a polypeptide chain amino acids are linked togetehr by which bond?

Insulin has two polypeptide chains. These polypeptide chains are held together by

The synthesis of a polypeptide chain or a protein from mRNA is called

The first amino acid in any polypeptide chain of prokaryote is always

A beta -pleated sheet organisation in a polypeptide chain is an example of

After the addition of the last amino acid to a growing polypeptide chain during the process of protein synthesis, one of the termination codons reaches the appropriate site on the ribosomal surface and then the following envents take place (i) Release of t-RNA molecule from the ribosome. (ii) Dislodging of polypeptide chain from the t-RNA (iii) Dissociation of ribosomes into large and small subunits. ltBrgt The correct sequence of these events:

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?