Home
Class 12
CHEMISTRY
In the given polypeptide Arg- Try -Ile...

In the given polypeptide
Arg- Try -Ile-Asn Gly
C - terminus amino acid is

A

Gly

B

Arg

C

Try

D

Asn

Text Solution

AI Generated Solution

The correct Answer is:
To determine the C-terminus amino acid in the given polypeptide chain, follow these steps: ### Step-by-Step Solution: 1. **Identify the Polypeptide Sequence**: The given polypeptide sequence is Arg-Try-Ile-Asn-Gly. 2. **Understand the Terminology**: In a polypeptide chain: - The **N-terminus** (or amino terminal) is the end of the chain that has a free amino group (-NH2). - The **C-terminus** (or carboxy terminal) is the end of the chain that has a free carboxyl group (-COOH). 3. **Determine the Directionality**: Polypeptides are synthesized from the N-terminus to the C-terminus. Therefore, the first amino acid in the sequence is at the N-terminus, and the last amino acid is at the C-terminus. 4. **Locate the C-terminus**: In the sequence Arg-Try-Ile-Asn-Gly: - Arg is at the N-terminus. - Gly is the last amino acid in the sequence, making it the C-terminus. 5. **Conclusion**: The C-terminus amino acid of the given polypeptide chain is Gly. ### Final Answer: The C-terminus amino acid is **Gly**. ---
Promotional Banner

Similar Questions

Explore conceptually related problems

In a polypeptide chain " N " terminal amino acid is always written towards

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

The iso-electric point of the given amino acid is,

Insulin (bovine) has 51 amino acids in A and B polypeptides. The polypeptide A possesses amino acids (a) 31 (b) 21 (c) 20 (d) 30

In a polypeptide chain of 125 amino acids, if the 25^(th) amino acid is mutated to UAA, then :-

Assertion : Last amino acid of any proteins is known as c terminal amino acid Reason : Last amino acid of any protein posses free COOH group

Statement-1 : Gly-Ala is a structural isomer pf Ala-Gly. Statement-2 : In Al-Gly, Alanine is the N -terminal amino acid.

A polypeptide on complete hydrolysis gives three amino acids. How many sequences are possible for A polypeptide on complete hydrolysis gives three amino acids. How many sequences are possible for that polypeptide?

Which of the following statements regarding the structure of proinsulin and mature insulin are not correct ? (i) Proinsulin is made up of three polypeptide chains -A,B and C (ii) c- polypeptide chain with 33 amino acids is removed prior to insulin formation (iii) Mature insulin is made up of 51 amino acids arranged in two polypeptide chain -A and B (iv) Polypeptide chain A has 30 amino acids and polypeptide chain B has 21 amino acids (v) Polypeptide chains A and B are interconnected by only one S-S linkage.

On translation , mRNA produce a polypeptide chain , which contains 50 amino acids. if 26^( th) codon of mRNA UUU mutated and changed to UUC , then the polypeptide chain will be