Which one of the following mRNA sequence...

Which one of the following mRNA sequences can be translated completely ?

A

AUGUUUCCUCAUUAGGGUGUU

B

GUGUUUCCUCAUGGUUGAGUU

C

AUGUUUCCUCAUGGUGUUUAA

D

AUGUUUCCUUGAAGGUUUUA

Verified by Experts

The correct Answer is:

C

Similar Questions

Explore conceptually related problems

Which one of the following sequence of groups in AMP ?

Refer to the given mRNA segment It can be translated completely into a polypeptide. Which of the following codons may correspond with A and B ?

Which of the following terms can be translated from the Greek as "to be carried"?

Which one of the following sequences was propsoed by Drawin and Wallace for organic evolution?

Which one of the following sequences was proposed by Darwin and Wallace for organic evolution?

Which of the following sequence of reagents can be used for the conversion of :

Which one of the following palindromic base sequences in DNA can be easily cut by EcoRI ?

Which one of the following palindromic base sequences in DNA can be easily cut at about the middle by some particular restriction enzyme?

Which one of the following palindromic base sequences in DNA can be easily cut a about the middle by some particular restriction enzyme ?