Home
Class 12
BIOLOGY
Polypeptide chain in eukaryotes is initi...

Polypeptide chain in eukaryotes is initiated by codons coding for amino acid

A

glycine

B

leucine.

C

methionine

D

lysine

Text Solution

AI Generated Solution

The correct Answer is:
To solve the question regarding the initiation of the polypeptide chain in eukaryotes, we can follow these steps: ### Step-by-Step Solution: 1. **Understanding the Question**: The question asks which amino acid is coded by the initiation codon in eukaryotes during the formation of a polypeptide chain. 2. **Identifying the Start Codon**: In eukaryotes, the polypeptide chain synthesis begins with a specific codon known as the start codon. The most common start codon is AUG. 3. **Codon and Amino Acid Relationship**: The start codon AUG codes for the amino acid methionine. This means that when the ribosome reads the AUG codon, it will incorporate methionine as the first amino acid in the polypeptide chain. 4. **Other Start Codons**: While AUG is the most common start codon, there are other codons such as GUG and UUG that can also serve as start codons in some cases. However, even when these codons are used, they typically lead to the incorporation of methionine. 5. **Conclusion**: Therefore, the polypeptide chain in eukaryotes is initiated by codons coding for the amino acid methionine. ### Final Answer: The polypeptide chain in eukaryotes is initiated by codons coding for the amino acid **methionine**. ---
Promotional Banner

Similar Questions

Explore conceptually related problems

Initiation codon in eukaryotes

Consider the following statements and choose the correct option :- (a) Six codons do not code for any amino-acid. (b) Codon is read in m-RNA in a contiguous fashion. (c) Three codons function as stop codons. (d) In eukaryotes the initiator codon AUG codes for methionine.

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

Initiator codon in eukaryotes

How many bases code for one amino acid?

The following codon do not code for any amino acid are

Which of the following statements regarding the structure of proinsulin and mature insulin are not correct ? (i) Proinsulin is made up of three polypeptide chains -A,B and C (ii) c- polypeptide chain with 33 amino acids is removed prior to insulin formation (iii) Mature insulin is made up of 51 amino acids arranged in two polypeptide chain -A and B (iv) Polypeptide chain A has 30 amino acids and polypeptide chain B has 21 amino acids (v) Polypeptide chains A and B are interconnected by only one S-S linkage.

The stretches of eukaryotic genes which do not code for amino acids are called

After the addition of the last amino acid to a growing polypeptide chain during the process of protein synthesis, one of the termination codons reaches the appropriate site on the ribosomal surface and then the following envents take place (i) Release of t-RNA molecule from the ribosome. (ii) Dislodging of polypeptide chain from the t-RNA (iii) Dissociation of ribosomes into large and small subunits. ltBrgt The correct sequence of these events:

Assertion: An amino acid in polypeptide chain is not altered due to change in third base of codon. Reason: It is due to Wobble hypothesis