Home
Class 12
BIOLOGY
If in m-RNA, base sequence is 5' - AUG C...

If in m-RNA, base sequence is 5' - AUG CUA UAC CUC CUU UAU CUG UGA-3'. How many amino acid residues will make up the polypeptide corresponding to this m-RNA

A

Ten

B

Seven

C

Eight

D

Eleven

Text Solution

AI Generated Solution

The correct Answer is:
To determine how many amino acid residues will make up the polypeptide corresponding to the given mRNA sequence, we can follow these steps: ### Step-by-Step Solution: 1. **Identify the mRNA Sequence**: The given mRNA sequence is: \[ 5' - AUG CUA UAC CUC CUU UAU CUG UGA - 3' \] 2. **Divide the Sequence into Codons**: mRNA is read in sets of three nucleotides called codons. We will break the sequence into codons: - AUG - CUA - UAC - CUC - CUU - UAU - CUG - UGA 3. **Count the Codons**: We count the number of codons formed: - Total codons = 8 4. **Identify the Amino Acids Corresponding to Each Codon**: - AUG → Methionine (Met) - CUA → Leucine (Leu) - UAC → Tyrosine (Tyr) - CUC → Leucine (Leu) - CUU → Leucine (Leu) - UAU → Tyrosine (Tyr) - CUG → Leucine (Leu) - UGA → Stop codon (termination) 5. **Determine the Number of Amino Acids**: The UGA codon is a stop codon, which means it does not code for an amino acid. Therefore, we will not count it in the total number of amino acids. Thus, the total number of amino acids coded by the sequence is: - Total amino acids = 8 codons - 1 stop codon = 7 amino acids ### Final Answer: The polypeptide corresponding to the given mRNA sequence will be made up of **7 amino acid residues**. ---
Promotional Banner

Topper's Solved these Questions

  • MOLECULAR BASIS OF INHERITANCE

    PHYSICS WALLAH|Exercise NEET Past 10 Years Questions |64 Videos
  • MOLECULAR BASIS OF INHERITANCE

    PHYSICS WALLAH|Exercise NEET Past 10 Years Questions |64 Videos
  • MINERAL NUTRITION

    PHYSICS WALLAH|Exercise NEET PAST 10 YEARS QUESTIONS |25 Videos
  • MORPHOLOGY OF FLOWERING PLANTS

    PHYSICS WALLAH|Exercise NEET Past 10 Years Questions|54 Videos

Similar Questions

Explore conceptually related problems

Give below is sequence of the processed mRNA ready for translation 5'AUG CUA UAC UAA CUG CCA UGC UAG-3' How many amino acids will present in polypeptide chain corresponding to theis mRNA

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

If base sequence in m-RNA is 5' UAC GUA CGU ACG UAC GUA CGU ACG 3' then what will be sequence of template strand?

If the base sequence in DNA is 5' AAAA 3' then the bases sequence in m-RNA is :-

The following sequence contains the open reading frame of a polypeptide. How many amino acids will the polypeptide consists of ? 5' AGCATATGATCGTTTCTCTGCTTTGAACT-3'

A strand of DNA has following base sequence 3'-AAAAGTFACTAGTGA-5' On transcription, it produces an m-RNA which of the following anticodon of t-RNA recognizes the third codon of this mRNA :-

How many amino acids will be coded by the mRNA sequence - 5 C C C U C A G U C A U A C 3' if a adensine residue is inserted after 12^(th) nucleotide ?

Leucine in one of three amino acids which are coded by 6 codons. The codons that code leucine are CUU, CUC, CUA, CUG, UUA, UUG How may minimum types of t RNA will be required for reading all codons of leucine ?

AUG GAC CUG AUA UUU UGA is the base sequence in a strand of m-RNA. (i) Write the base sequence of the DNA strand from which it has been transcribed. (ii) Upon translation, how many amino acids will be the resulting peptide have?

PHYSICS WALLAH-MOLECULAR BASIS OF INHERITANCE -Level-2
  1. In a piece of DNA, adenine is 22.4%, cytosine is 31.3% guanine is 13.4...

    Text Solution

    |

  2. According to Chargaff's rule, which of the following statements about ...

    Text Solution

    |

  3. A sequence of three consecutive bases in a tRNA molecule specifically ...

    Text Solution

    |

  4. The function of nucleases is to:

    Text Solution

    |

  5. A completely radioactive double standed DNA molecule undergoes two rou...

    Text Solution

    |

  6. Which of the following m-RNA is translated completely :- (A) 5' AUG ...

    Text Solution

    |

  7. If in m-RNA, base sequence is 5' - AUG CUA UAC CUC CUU UAU CUG UGA-3'....

    Text Solution

    |

  8. DNA replication is semiconservative as

    Text Solution

    |

  9. How are RFLPs detected?

    Text Solution

    |

  10. Sequenciong the whole set of genome that contained all the coding and ...

    Text Solution

    |

  11. The salient feature of DNA are - (i) It is made of two polynucleotid...

    Text Solution

    |

  12. If the sequence of bases in one strand of DNA is known then the sequen...

    Text Solution

    |

  13. Which process is used for amplication or multiplication of DNA for fin...

    Text Solution

    |

  14. Main enzyme of transcription-

    Text Solution

    |

  15. Which is incorrect for genetic code? (i) The codon is triplet (ii)...

    Text Solution

    |

  16. An alien DNA-like molecule is isolated from the frozen remains of a ma...

    Text Solution

    |

  17. Which is correct? (i) t-RNA has an anticodon loop that has bases c...

    Text Solution

    |

  18. DNA exists in a double-stranded form whereas RNA is mainly a single s...

    Text Solution

    |

  19. The promoter site and the terminator site for transcription are locate...

    Text Solution

    |

  20. In Hershey and Chase experiments , radioactive .^(32)P was used to cul...

    Text Solution

    |