If the coding sequence in a transcription unit is written as follows:
5'TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of mRNA.

If the sequence of the coding strand in a transcription unit is written as follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3' Write down the sequence of mRNA.

If the sequence of one strand of DNA is written as follows: 5'-ATGCATGCATGCA’TGCATGCATGCATGC-3' Write down the sequence of complementary strand in 5' - 3' direction.

Write an palindrome sequence of DNA.

Coding sequences of mRNA ______

Name the non coding sequences of mRNA ____

The sequence of stages of mitotic cell division is as follows:

Coding sequences found in split genes are called.

Write briefly about S-D sequence.

Non-coding sequences of mRNA ______

Write down the power set of A = {3, {4, 5}}.