Home
Class 14
CDP
If a student becomes aggressive frequent...

If a student becomes aggressive frequently under normal conditions, how would you train him in emotional control?

A

(a) Applying punitive measures at the time of such behavioural expressions

B

(b) Applying threat of expulsion from school

C

(c) Advise him to join the Child Guidance Clinic

D

(d) Monitor his behaviour through various scientific observations

Text Solution

Verified by Experts

The correct Answer is:
D
Promotional Banner

Topper's Solved these Questions

  • PRACTICE SET 8

    DISHA PUBLICATION |Exercise QUESTION BANK|39 Videos

  • PRACTICE SET-1

    DISHA PUBLICATION |Exercise QUESTION BANK|40 Videos

Similar Questions

Explore conceptually related problems

How many alkali metals form oxide under normal conditions.

How many elements are found as gases under normal conditions (1 atm and 25^(@)C) ?

If a person exhales out forcefully by applying all his efforts, what will be the pulmonary volume inhaled by him immediately under normal condition without applying any extra effort ?

If you get an opportunity of teach a blind student along with normal students, what type of treatment would you like to give him in the class?

If a students alledent against you for showing favouritism in evaluation of scripts,how would you deal with him?

Suppose a student a smoker and generally he misses a period or comes late due to smoking. How would you like to compromise with such a student in the class?

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

A scheduled caste student is admitted in your class. The other classmates treat him as untouchable and live in isolation. How would you give him better adjustment in the class?

DISHA PUBLICATION -PRACTICE SET 9-QUESTION BANK
  1. Suppose an intelligent boy of your class requests for a particular boo...

    Text Solution

    |

  2. If you get an opportunity of teach a blind student along with normal s...

    Text Solution

    |

  3. When a child is stammering in your class, the student collectively mak...

    Text Solution

    |

  4. A scheduled caste student is admitted in your class. The other classma...

    Text Solution

    |

  5. If a student has the problem of enuresis, the child’s parents acquaint...

    Text Solution

    |

  6. Suppose luckily you get an opportunity to serve in a minority institut...

    Text Solution

    |

  7. If a student becomes aggressive frequently under normal conditions, ho...

    Text Solution

    |

  8. The sex drive in humans & higher primates is largely triggered by

    Text Solution

    |

  9. The set -point theory has been advanced in the area of

    Text Solution

    |

  10. In programmed learning, the behaviour of the learner is shaped correct...

    Text Solution

    |

  11. Education psychology is oriented towards

    Text Solution

    |

  12. Pre- service training of elementary teachers should basically focus on...

    Text Solution

    |

  13. As per the views of psychologists, in which age should the child be ad...

    Text Solution

    |

  14. The basic aim of Heuristic strategy in teaching of mathematics is

    Text Solution

    |

  15. Which one of the following is not the characteristic of Question Answe...

    Text Solution

    |

  16. Where are the points of information and summative assessment ?

    Text Solution

    |

  17. Defective question are

    Text Solution

    |

  18. The teacher should ask the questions.

    Text Solution

    |

  19. Which problem in classroom is due to curriculum?

    Text Solution

    |

  20. The development of the lesson planning occurred as a result of

    Text Solution

    |