Home
Class 11
BIOLOGY
In a polypeptide chain " N " terminal am...

In a polypeptide chain " N " terminal amino acid is always written towards

A

Left side

B

Right side

C

In the middle

D

All the above

Text Solution

AI Generated Solution

The correct Answer is:
To solve the question "In a polypeptide chain, the N terminal amino acid is always written towards," we can follow these steps: ### Step-by-Step Solution: 1. **Understand the Structure of a Polypeptide Chain**: - A polypeptide chain is made up of amino acids linked together by peptide bonds. Each amino acid has two terminals: the N terminal and the C terminal. 2. **Identify the N Terminal**: - The N terminal (or amino terminal) is the end of the polypeptide chain that has a free amino group (-NH2) attached to the alpha carbon of the first amino acid in the chain. 3. **Identify the C Terminal**: - The C terminal (or carboxyl terminal) is the end of the polypeptide chain that has a free carboxyl group (-COOH) attached to the alpha carbon of the last amino acid in the chain. 4. **Determine the Orientation**: - When writing out a polypeptide chain, the convention is to start from the N terminal and move towards the C terminal. Therefore, the N terminal is always written on the left side of the polypeptide chain. 5. **Conclusion**: - Based on the above understanding, the answer to the question is that the N terminal amino acid is always written towards the left side. ### Final Answer: The N terminal amino acid is always written towards the **left side**. ---
Promotional Banner

Topper's Solved these Questions

  • BIOMOLECULES

    AAKASH SERIES|Exercise EXERCISE - I (Enzymes -Introduction)|13 Videos

  • BIOMOLECULES

    AAKASH SERIES|Exercise EXERCISE - I (Chemical reactions)|4 Videos

  • BIOLOGICAL CLASSIFICATION

    AAKASH SERIES|Exercise EXERCISE-III (Previous AIPMT/NEET Question)|37 Videos

  • CELL CYCLE AND CELL DIVISION

    AAKASH SERIES|Exercise Exercise-III|18 Videos

Similar Questions

Explore conceptually related problems

In a polypeptide chain of 125 amino acids, if the 25^(th) amino acid is mutated to UAA, then :-

Each polypeptide in a protein has amino acids linked with each other in a specific sequence. This sequence of amino acids is said to be... .

Each polypeptide in a protein has amino acids linked with each other in a specific sequence. This sequence of amino acids is said to be... .

In a polypeptide chain amino acids are linked togetehr by which bond?

On translation , mRNA produce a polypeptide chain , which contains 50 amino acids. if 26^( th) codon of mRNA UUU mutated and changed to UUC , then the polypeptide chain will be

How many coded nitrogen bases are present in m-RNA from which a polypeptide chain with 60 amino acids is formed in bacteria cells, (including nonsense codon)?

Statement I: Insulin is a globular protein. Statement II: It has two polypeptide chains with 21 and 30 amino acids joined by sulhur bridges connecting cysteine amino acid on the two chains.

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

Assertion : Last amino acid of any proteins is known as c terminal amino acid Reason : Last amino acid of any protein posses free COOH group

Which of the following statements regarding the structure of proinsulin and mature insulin are not correct ? (i) Proinsulin is made up of three polypeptide chains -A,B and C (ii) c- polypeptide chain with 33 amino acids is removed prior to insulin formation (iii) Mature insulin is made up of 51 amino acids arranged in two polypeptide chain -A and B (iv) Polypeptide chain A has 30 amino acids and polypeptide chain B has 21 amino acids (v) Polypeptide chains A and B are interconnected by only one S-S linkage.