Home
Class 11
BIOLOGY
How many coded nitrogen bases are presen...

How many coded nitrogen bases are present in m-RNA from which a polypeptide chain with 60 amino acids is formed in bacteria cells, (including nonsense codon)?

A

200

B

60

C

180

D

183

Text Solution

AI Generated Solution

The correct Answer is:
To determine how many coded nitrogen bases are present in mRNA from which a polypeptide chain with 60 amino acids is formed in bacterial cells (including nonsense codon), we can follow these steps: ### Step-by-Step Solution: 1. **Identify the Number of Amino Acids**: - We are given that the polypeptide chain consists of 60 amino acids. 2. **Calculate the Number of Codons for Amino Acids**: - Each amino acid is coded by a codon, and each codon consists of 3 nitrogen bases (nucleotides). - Therefore, for 60 amino acids, the number of codons required is: \[ \text{Number of codons} = 60 \text{ amino acids} \] 3. **Calculate the Total Number of Nitrogen Bases for Amino Acids**: - Since each codon consists of 3 nitrogen bases, the total number of nitrogen bases for the amino acids is: \[ \text{Total nitrogen bases for amino acids} = 60 \times 3 = 180 \] 4. **Include the Stop Codon**: - In addition to the codons for the amino acids, there is 1 stop codon that signals the end of translation. - The stop codon also consists of 3 nitrogen bases. - Therefore, we need to add the nitrogen bases from the stop codon: \[ \text{Total nitrogen bases including stop codon} = 180 + 3 = 183 \] 5. **Final Answer**: - The total number of coded nitrogen bases present in mRNA, including the stop codon, is 183. ### Conclusion: The correct answer is **D. 183**.
Promotional Banner

Topper's Solved these Questions

  • BIOMOLECULES

    AAKASH SERIES|Exercise EXERCISE - II (Enzymes)|12 Videos
  • BIOMOLECULES

    AAKASH SERIES|Exercise EXERCISE - III (Previous AIPMT/NEET Questions)|84 Videos
  • BIOMOLECULES

    AAKASH SERIES|Exercise EXERCISE - II (Lipids)|18 Videos
  • BIOLOGICAL CLASSIFICATION

    AAKASH SERIES|Exercise EXERCISE-III (Previous AIPMT/NEET Question)|37 Videos
  • CELL CYCLE AND CELL DIVISION

    AAKASH SERIES|Exercise Exercise-III|18 Videos

Similar Questions

Explore conceptually related problems

How many kinds of nitrogenous bases are present in nucleic acids?

Polypeptide chain in eukaryotes is initiated by codons coding for amino acid

A prokaryote gene of 600 nucleotides long can code for a polypeptide chain of about, how many amino acids ?

How many bases code for one amino acid?

How many base pairs in the gene are needed to code for the enzyme lysozyme, containing 129 amino acids, found in egg white?

Read the following statements. (i) One codon codes for only one amino acid. (ii) Some amino acids are coded by more than one codon. (iii) The sequence of triplet nitrogenous bases in DNA of mRNA coresponds to the amino acid sequence in the polypeptide chain. Give , suitabel terms for the characteristics of 'genetic code' as per the above statements.

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

A bacterial cell was transformed with a recombinant DNA that was generated using a human gene. However, the transformed cells did not produce the desired protein. Reason could be (a) Human gene may have intron which bacteria cannot process (b) Amino acid codons for humans and bacteria are different (c) Human protein is formed but degraded by bacteria (d) all of the above

On translation , mRNA produce a polypeptide chain , which contains 50 amino acids. if 26^( th) codon of mRNA UUU mutated and changed to UUC , then the polypeptide chain will be

Assertion: An amino acid in polypeptide chain is not altered due to change in third base of codon. Reason: It is due to Wobble hypothesis

AAKASH SERIES-BIOMOLECULES-EXERCISE - II (Nucleic acids)
  1. Number of phosphodiester bonds in one turn of DNA

    Text Solution

    |

  2. The t RNA molecules with the following anti codons do not exist in cel...

    Text Solution

    |

  3. A fragment of DNA has 480 nucleotides out of which 110 are those of ad...

    Text Solution

    |

  4. How many H-bonds are formed between the two strands of dsDNA of 170A^(...

    Text Solution

    |

  5. If the DNA fragment of length 102A has 8 adenines, what is the number ...

    Text Solution

    |

  6. How many hydrogen bonds are present between complementary nitrogen bas...

    Text Solution

    |

  7. Chargaff rule is not applicable to

    Text Solution

    |

  8. The length of DNA in one chromosome is 510 A^(@). It has 20% of 6-amin...

    Text Solution

    |

  9. How many coded nitrogen bases are present in m-RNA from which a polype...

    Text Solution

    |

  10. An organism exclusively with 70S type of ribosomes contains one of the...

    Text Solution

    |

  11. The arrangement of atoms and molecular groups in DNA and RNA can be st...

    Text Solution

    |

  12. Arrange the following in ascending order based upon their molecular we...

    Text Solution

    |

  13. In DNA the oxygen atom is lost from the pentose sugar molecule at this...

    Text Solution

    |

  14. The term nucleic acids was given by

    Text Solution

    |

  15. Nucleic acids were discovered in the nuclei of

    Text Solution

    |

  16. phixx-174 bacteriophage has

    Text Solution

    |

  17. If there is a double stranded DNA virus particle with 20,000 base pair...

    Text Solution

    |

  18. A+G = C+T, then it is

    Text Solution

    |

  19. The unit which is formed by sugar and nitrogen- base linked by glycos...

    Text Solution

    |

  20. The proteins associated with nucleic acids are

    Text Solution

    |