How many fragments will be generated if you digest a linear DNA molecule with a restriction enzyme having four recognition sites on the DNA?
3
6
5
4

How many fragments will be generated if you digest a linear DNA molecule with a restriction enzyme having four recognition sites on the DNA? (a) 3 (b) 6 (c) 5 (d) 4

How many fragments will be generated on the digestion of a closed circular DNA molecule with a restriction enzyme having six recongnition sites on the DNA ?

A fragment of DNA, cut by a restriction enzyme, forms bonds with other DNA molecules that have

The vector also have one unique recognition site to enable foreign DNA to be inserted into the vector during the generation of an rDNA molecule. Most of the commonly used vectors contains unique recognition sites region of DNA which is referred to as a polylinker or multiple cloning site (MCS). An MCS provides:

Assume that you are trying to insert a gene into a plasmid and someone gives you a preparation of DNA cut with restriction enzyme X. The gene you wish to insert has sites on both ends for cutting by restriction enzyme Y. You have a plasmid with a single site for Y, but not for X. Your strategy should be to

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

Read the following statements and select the correct ones. (i) Same kind of sticky ends are produced when a DNA has been cut by different restriction enzymes. (ii) Exonucleases make cuts at specific positions within the DNA. (iii) Hind ll was the first restriction endonuclease to be isolated. (iv) A bacteriophage has the ability to replicate within bacterial cells by integrating its DNA with bacterial DNA. (v) Presence of more than one recognition sites for a enzyme within the vector facilitates the gene cloning.

A plasmid has two antibiotic-resistance genes, one for tetracycline and other for ampicillin. It is treated with a restriction enzyme that cuts in the middle of the ampicillin gene. DNA fragments containing a haemoglobin gene were cut with the same enzyme. The plasmids and fragments are mixed, treated with ligase and used to transform bacterial cells. Clones that have taken up the recombinant DNA are the ones that

Read the given statements and select the correct option. Statement 1 : The cloning vector is required to have very few, preferably single, recongnition sites for the commonly used restriction enzymes. Statement 2: Presence of more than one recongnition sites within a cloning vector will generate several fragments, which will complicate the process of gene cloining. 1) Both statements 1 and 2 are correct 2) statement 1 is correct but statement 2 is incorrect 3) statement 1 is incorrect but statement 2 is correct 4) None of the above

How many integers of four digits each can be formed with the digits 0,1,3,5,6 (assuming no repetitions)