Step by step text solution for Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand. a. What is the objective of this action? b. Explain how the gene of interest is introduced into a vector. c. You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity. d.A gene M was introduced into E.coli cloning vector PBR322 at BamH1 site. What will be its impact on the recombinant plamids? Give a possible way by which you could differentiate non recombinant to recombinant plasmids. by BIOLOGY experts to help you in doubts & scoring excellent marks in Class 12 exams.