Gravitation|Part-2|Class 9th,11th,SSC,NDA,IIT-JEE,NEET|#RajeshSutharSir

Gravitation|Part-3|Class 9th,11th,SSC,NDA,IIT-JEE,NEET|#RajeshSutharSir

Law of Parallelogram | Vector | Class XI Physics | IIT JEE | NEET

Venturi Meter | Mechanical Properties of Fluids | Class XI Physics | IIT JEE | NEET | CBSE

If the earth has mass 9 times and radius twice that of the planet Mars, calculate the minimum velocity required by a rocket to pull out of the gravitational force of Mars. Escape velocity on the surface of the earth in 11.2 km//s

Class 11 || Straight Line || slope and intercept || IIT -JEE

Flow Rate Problem | Class XI Physics | Properties of Fluids | IIT JEE | NEET | CBSE

How many cars did the 9th grade class wash during the car wash?

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?