Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single stranded DNA. BamH1 is one such restriction enzyme which binds at the recognition sequence, 5'-GGATCC-3' and cleaves these sequences just after the 5'- guanine on each strand.
You are given the DNA shown below.
5' ATTTTGAGGATCCGTAATGTCCT 3
3' TAAAACTCCTAGGCATTACAGGA 5
If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.

Explanation

To solve the problem, we need to analyze the given DNA sequence and determine where the BamHI restriction enzyme will cut it.

### Step-by-Step Solution:

1. **Identify the Recognition Sequence**:
The recognition sequence for BamHI is 5'-GGATCC-3'. We need to find this sequence in the provided DNA strands.

2. **Locate the Recognition Sequence**:
...