Home
Class 12
BIOLOGY
A polypeptide has the following amino ac...

A polypeptide has the following amino acid sequence
Met-Ser-Pro-Arg-Leu-Glu-Gly
In a mutant the amino acid sequence of this polypeptide was found to be
Met-Ser-Ser-Arg-Leu-Glu-Gly
What is the type of mutation that occurred in the reading frame of its DNA?

A

Silent mutation

B

Nonesense mutation

C

Mis-sense mutation

D

Frame-shift mutation

Text Solution

Verified by Experts

The correct Answer is:
C
Promotional Banner

Topper's Solved these Questions

  • MINERAL NUTRITION

    TRUEMAN BIOLOGY|Exercise MULTIPLE CHOICE QUESTIONS|388 Videos

  • Monera

    TRUEMAN BIOLOGY|Exercise ASSERTION AND REASON|14 Videos

Similar Questions

Explore conceptually related problems

Read the following statements. (i) One codon codes for only one amino acid. (ii) Some amino acids are coded by more than one codon. (iii) The sequence of triplet nitrogenous bases in DNA of mRNA coresponds to the amino acid sequence in the polypeptide chain. Give , suitabel terms for the characteristics of 'genetic code' as per the above statements.

The following sequence contains the open reading frame of a polypeptide. How many amino acids will the polypeptide consists of ? 5' AGCATATGATCGTTTCTCTGCTTTGAACT-3'

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

In the given polypeptide Arg- Try -Ile-Asn Gly C - terminus amino acid is

Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it: UUUAUGUUCGAGUUAGUGUAA Phe-Met-Phe-Glu-Leu-Val Write the properties of genetic code that can be and that cannot be correlated from the above given data.

A small stretch of DNA strand that codes for a polypeptide is shown below: 3' -- ----- CAT CAT AGA TGA AAC --- --- -- 5' (a) Which type of mutation could have occurred in each type resulting in the following mistake during replication of the above original sequence ? i. 3' ..... ... ... CAT CAT AGA TGA ATC... .... .. 5' ii. 3' ... ... ...CAT ATA GAT GAA AC..... .... ..5' (b) How many amino acids will be translated from each of the above strands (i) and (ii) ?

mRNA overset(AUG UUU AUG C CU GUU UCU UA A)to Polypeptide Met-Phe-Met-Pro-Val-Ser Which codons respectively code for proline and valine amino acids in the given polypeptide chain, respectively ?

Given below are the steps of protein synthesis. Arrange them in correct sequence and select the correct option. (i) Codon- anticodon reaction between mRNA and aminoacyl tRNA complex. (ii) Attachment of mRNA and smaller sub-unit of ribosome. (iii) Charging or aminoacylation of tRNA . (iv) Attachment of larger sub-unit of ribosome to the mRNA-tRNA _("Met") complex. (v) Linking of adjacent amino acids. (vi) Formation of polypeptide chain.

In an in vitro translation experiment, poly (UC) RNA template produced poly (Ser-Leu), while poly (AG) RNA template produced poly (Arg-Glu) polypeptide. Which ONE of the following options represents correct interpretations of the codons assignments for Ser, Leu, Arg, and Glu.

TRUEMAN BIOLOGY-MOLECULAR BASIS OF INHERITANCE-MCQs
  1. A sequence of nucleotides on DNA 'CATCATCATCAT' is changed through mut...

    Text Solution

    |

  2. Which one of the following human genes has the longest stretch of DNA ...

    Text Solution

    |

  3. A polypeptide has the following amino acid sequence Met-Ser-Pro-Arg-...

    Text Solution

    |

  4. A DNA molecule having A+G//C+T=0.71 shows that the molecule is:

    Text Solution

    |

  5. On a planet from a distant galaxy, the pilot vehicle collected a sampl...

    Text Solution

    |

  6. Would an oligopeptide result from m-RNA seqnece given below? How many ...

    Text Solution

    |

  7. During electrolphoresis, DNA fragment would migrate

    Text Solution

    |

  8. A base pair change

    Text Solution

    |

  9. Which of the following is true about a viriod

    Text Solution

    |

  10. Read the description given below:- 1. They are nucleic acids 2. Th...

    Text Solution

    |

  11. In a charged transfer RNA, the nucleotide bound to the amino acid is a...

    Text Solution

    |

  12. The technique used for analysis of RNA is called

    Text Solution

    |

  13. Which of the following statements is not true for retroviruses?

    Text Solution

    |

  14. E. colicells with a mutated z gene of the lac operon cannot grow in me...

    Text Solution

    |

  15. Telomerase is an enzyme which is a

    Text Solution

    |

  16. Which of the following is not true for operon concept of jacobe and mo...

    Text Solution

    |

  17. A regularity gene produces some kind of protein through its m-RNA that...

    Text Solution

    |

  18. How many high-energy phosphate bond equivalents are utilized in the pr...

    Text Solution

    |

  19. Given a hypothetical segment of functional DNA strand 3'-GGC AAC CTT G...

    Text Solution

    |

  20. Consider the following events in DNA replication 1. Formation of RNA...

    Text Solution

    |