If the sequence of the coding strand in a transcription unit is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'. Write down the sequence of mRNA.

If the sequence of the coding strand in a transcription unit is written as follows: 5'-ATGCATGCATGATGCAGCATGCATGCATGC-3' write down the sequence of mRNA.

If the sequence of coding strand in a transcription unit is written as follows : 5' -ATGCATGCATGCATGCATGCATGCATGC-3' Write down the sequence of mRNA.

If the sequence of coding strand in transcription unit is written as follows: 5' ATGC ATGC ATGC ATGC ATGC ATGC ATGC 3' Write down the sequence of mRNA.

If the coding sequence in a transcription unit is written as follows: 5'TGCATGCATGCATGCATGCATGCATGC 3' Write down the sequence of mRNA.

If the sequence of Coding strands in a transcription unit is written as follows:S'-ATGCATGTCA ATGC ATGC ATGC-3' Write down the sequence of mRNA.

If the sequence of the coding strand in a transcription unit is written as follows 5' -ATGCCTAGGTCCAGGCAT-3' Write down the sequence of mRNA. Write down the anticodon for each code and their corresponding amino acids.

If the sequence of the coding dna strand in a transcription unit is written as following: 5' - ATGCATGCATGCATG - 3' write down the sequence of m RNA.

If the sequence of the coding strand in a transcription unit is as follows: 5-ATGCCTAGGTCCAGGCAT-3 Write down the sequence of mRNA. Write down the anticodon for each code and their corresponding amino acids

If the sequence of coding strand in a transcription units is written as follows: 5 - C G T A T C G A T C G G T T C G A -3 Write down the sequence of complementary stand in 3 to 5 direction.