Home
Class 12
BIOLOGY
The given nucleotide sequence on mRNA is...

The given nucleotide sequence on mRNA is as shown below :
5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3'
(A) How many amino acids will be inserted in a polypeptide chain under normal conditions?
(B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

A

(A) 4, (B) 9

B

(A) 4, (B) 7

C

(A) 6, (B) 8

D

(A) 5, (B) 7

Text Solution

AI Generated Solution

The correct Answer is:
To solve the problem, we will analyze the given mRNA sequence and determine the number of amino acids that will be inserted into a polypeptide chain under two different conditions: normal and mutated. ### Step-by-Step Solution **Step 1: Identify the mRNA sequence.** The given mRNA sequence is: 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' **Step 2: Divide the mRNA sequence into codons.** Codons are groups of three nucleotides. We will divide the sequence into codons: - AUG | UCA | UGG | GAG | UGA | GUU | GGC | UAA | UAG **Step 3: Count the number of codons.** From the division, we can see that there are 9 codons in total. **Step 4: Identify the stop codons.** The stop codons are UAA, UGA, and UAG. In our sequence, UGA and UAA are present. When a stop codon is reached, the synthesis of the polypeptide chain stops. **Step 5: Determine the number of amino acids in normal conditions.** - The first codon (AUG) is a start codon and codes for Methionine (1 amino acid). - The second codon (UCA) codes for Serine (2 amino acids). - The third codon (UGG) codes for Tryptophan (3 amino acids). - The fourth codon (GAG) codes for Glutamic acid (4 amino acids). - The fifth codon (UGA) is a stop codon. Thus, the synthesis stops after the fourth amino acid. Therefore, under normal conditions, **4 amino acids** will be inserted into the polypeptide chain. **Step 6: Analyze the mutated situation.** In the mutated situation, the 9th nucleotide is deleted. The original sequence of codons is: - AUG | UCA | UGG | GAG | UGA | GUU | GGC | UAA | UAG If we delete the 9th nucleotide (which is the first 'G' in UGA), the new sequence becomes: - AUG | UCA | UGG | GAG | UGU | GGC | UAA **Step 7: Count the new codons.** Now, we have: - AUG (Methionine) - UCA (Serine) - UGG (Tryptophan) - GAG (Glutamic acid) - UGU (Cysteine) - GGC (Glycine) - UAA (Stop codon) **Step 8: Determine the number of amino acids in the mutated situation.** In this case, the synthesis will stop after the sixth codon (UAA). Therefore, under the mutated condition, **6 amino acids** will be inserted into the polypeptide chain. ### Final Answers (A) Under normal conditions, 4 amino acids will be inserted. (B) In the mutated situation, 6 amino acids will be inserted.
Promotional Banner

Topper's Solved these Questions

  • NTA NEET SET 27

    NTA MOCK TESTS|Exercise BIOLOGY|90 Videos
  • NTA NEET SET 29

    NTA MOCK TESTS|Exercise BIOLOGY|90 Videos

Similar Questions

Explore conceptually related problems

How many amino acids are present in the following polypeptide chain ?

How many amino acids are arranged in tow chains of insullin?

Give below is sequence of the processed mRNA ready for translation 5'AUG CUA UAC UAA CUG CCA UGC UAG-3' How many amino acids will present in polypeptide chain corresponding to theis mRNA

A: Polypeptide sequence are dictated by DNA and represented by mRNA. R: Sequence of amino acids in a polypeptide can be predicted by the exact sequence of nucleotides on the mRNA and template DNA.

In a polypeptide chain of 125 amino acids, if the 25^(th) amino acid is mutated to UAA, then :-

A prokaryotic gene of 600 nucleotides long can code for a polypeptide chain of about, how many amino acids?

How many amino acids will be coded by the mRNA sequence - 5 C C C U C A G U C A U A C 3' if a adensine residue is inserted after 12^(th) nucleotide ?

On translation , mRNA produce a polypeptide chain , which contains 50 amino acids. if 26^( th) codon of mRNA UUU mutated and changed to UUC , then the polypeptide chain will be

Study the mRNA segment given above which is to be translated into a polypeptide chain. (i) Write the codons 'a' and 'b' (ii) What do they code for (iii) How is peptide bond formed between two amino acids in the ribosome?

NTA MOCK TESTS-NTA NEET SET 28-BIOLOGY
  1. Tendons

    Text Solution

    |

  2. Which of the following statements is correct about cockroach ?

    Text Solution

    |

  3. Which of the following points were not explained by Schleiden and Schw...

    Text Solution

    |

  4. Which one of the following fits the below description ? It is a singl...

    Text Solution

    |

  5. Find the odd one out from the following:

    Text Solution

    |

  6. There are 20 different types of amino acids that help in the formation...

    Text Solution

    |

  7. Read the following statements below. I. All the carbon compounds that...

    Text Solution

    |

  8. In terms of percentage of the total cellular mass, the correct arrange...

    Text Solution

    |

  9. How is the DNA of the cell affected during S-phase of the cell cycle ?

    Text Solution

    |

  10. In plants, the process of gamete formation involves

    Text Solution

    |

  11. Under which of the following condition, the oxyhaemoglobin dissociatio...

    Text Solution

    |

  12. Select the statement that is correct related to movement of diaphragm ...

    Text Solution

    |

  13. Which of these statements of comparison regarding DNA and RNA holds tr...

    Text Solution

    |

  14. Which statement/s is/are incorrect regarding DNA ? I. DNA has a doub...

    Text Solution

    |

  15. The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAU...

    Text Solution

    |

  16. Which of the following restriction endonucleases cannot be used while ...

    Text Solution

    |

  17. Which of the following graphs best depicts the changes in one cycle of...

    Text Solution

    |

  18. The number of nucleotides present in the restriction sequence of the f...

    Text Solution

    |

  19. Probe used in molecular diagnosis of diseases can be

    Text Solution

    |

  20. Match the columns correctly.

    Text Solution

    |