Home
Class 12
BIOLOGY
A gene encoding for a polypeptide of 60 ...

A gene encoding for a polypeptide of 60 amino acids get mutated at `30^(th)` codon UAU becoming UAA The result would be

A

A polypeptide of 29 amino acids

B

Two polypeptides one with 29 amino acids and second with 31 amino acids.

C

A polypeptide with 59 amino acids.

D

A polypeptide of 25 amino acids.

Text Solution

AI Generated Solution

The correct Answer is:
To solve the problem, we need to analyze the mutation of the gene encoding a polypeptide of 60 amino acids at the 30th codon. Here’s the step-by-step solution: ### Step 1: Understand the Original Codon The original codon at the 30th position is UAU, which codes for the amino acid Tyrosine (Tyr). ### Step 2: Identify the Mutation The mutation changes the 30th codon from UAU to UAA. UAA is one of the three stop codons (along with UAG and UGA) that signal the termination of protein synthesis. ### Step 3: Determine the Effect of the Mutation Since UAA is a stop codon, the translation process will terminate at this point. This means that no further amino acids will be added to the growing polypeptide chain after the 29th amino acid. ### Step 4: Calculate the Length of the Resulting Polypeptide The original polypeptide was supposed to be 60 amino acids long. However, due to the mutation at the 30th codon, the synthesis will stop after the 29th amino acid. Therefore, the resulting polypeptide will consist of 29 amino acids. ### Conclusion The result of the mutation will be a polypeptide of 29 amino acids. ### Final Answer The correct answer is: A polypeptide of 29 amino acids. ---
Promotional Banner

Topper's Solved these Questions

  • NTA NEET SET 67

    NTA MOCK TESTS|Exercise BIOLOGY|90 Videos
  • NTA NEET SET 69

    NTA MOCK TESTS|Exercise BIOLOGY|90 Videos

Similar Questions

Explore conceptually related problems

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA ?

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25^(th) codon (UAU) is mutated to UA A?

In a polypeptide chain of 125 amino acids, if the 25^(th) amino acid is mutated to UAA, then :-

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

Predict the effect if, the codon UAU coding for an amino acid at the 25^(th) position of a polypeptide of 50 amino acids, is mutated to UAA.

In 125 amino acid sequence if the codon of 25th amino acid is mutated to UAA, then

Polypeptide chain in eukaryotes is initiated by codons coding for amino acid

A gene that was 5055 bp long resulted in three polypeptides-350 amino acids long, 450 amino acids long and 1500 amino acis long. The most likely reason for this is

NTA MOCK TESTS-NTA NEET SET 68-BIOLOGY
  1. Methylophilus methylotrophus bacterium as SCP produces more

    Text Solution

    |

  2. Which of these hormones decrease the amount of sodium lost by the body...

    Text Solution

    |

  3. A gene encoding for a polypeptide of 60 amino acids get mutated at 30^...

    Text Solution

    |

  4. Read the following statements about the human female reproductive syst...

    Text Solution

    |

  5. Read the following given examples: (i) Plant - pollinator mutualism....

    Text Solution

    |

  6. Diseases are broadly grouped into infectious and non-infectious diseas...

    Text Solution

    |

  7. Increase in GFR can be due to :

    Text Solution

    |

  8. Rate of biomass production is expressed as :

    Text Solution

    |

  9. BOD of waste water is estimated by measuring the amount of

    Text Solution

    |

  10. Polydipsia , hyperglycemia and polyuria occur due to

    Text Solution

    |

  11. Majority of transgenic animals are :

    Text Solution

    |

  12. Which one of the following alcoholic drink has the least proportion of...

    Text Solution

    |

  13. The sequence of nucleotides AUGCUUCUC indicates that it is a segment i...

    Text Solution

    |

  14. Which of these vaccines is not given against viral diseases ?

    Text Solution

    |

  15. The site for the production of an enzyme, the deficiency of which caus...

    Text Solution

    |

  16. What is meant by contact inhibition ?

    Text Solution

    |

  17. If we completely remove the decomposers from an ecosystem, the ecosyst...

    Text Solution

    |

  18. Find the INCORRECT pairing.

    Text Solution

    |

  19. In your opinion, which is the most effective way to conserve the plant...

    Text Solution

    |

  20. The regulatory protein of skeletal muscles whose filaments run close t...

    Text Solution

    |