Home
Class 12
CHEMISTRY
In the given polypeptide Arg- Try -Ile...

In the given polypeptide
Arg- Try -Ile-Asn Gly
C - terminus amino acid is

A

Gly

B

Arg

C

Try

D

Asn

Text Solution

AI Generated Solution

The correct Answer is:
To determine the C-terminus amino acid in the given polypeptide sequence Arg-Tyr-Ile-Asn-Gly, we can follow these steps: ### Step-by-Step Solution: 1. **Identify the Structure of Amino Acids**: Each amino acid has a basic structure consisting of an amino group (-NH2), a central carbon atom (C), a carboxylic acid group (-COOH), and a variable side chain (R group). 2. **Understand Polypeptide Orientation**: In a polypeptide, the amino acids are linked together by peptide bonds. The sequence of amino acids is always written from the N-terminus (the end with the amino group) to the C-terminus (the end with the carboxylic acid group). 3. **Analyze the Given Sequence**: The sequence provided is Arg-Tyr-Ile-Asn-Gly. Here, Arg (Arginine) is the first amino acid, and Gly (Glycine) is the last amino acid in the sequence. 4. **Determine the C-terminus**: The C-terminus of a polypeptide is the last amino acid in the sequence, which has a free carboxylic acid group. In this case, Glycine (Gly) is at the end of the sequence. 5. **Conclusion**: Therefore, the C-terminus amino acid of the given polypeptide Arg-Tyr-Ile-Asn-Gly is Glycine (Gly). ### Final Answer: The C-terminus amino acid is Glycine (Gly). ---
Promotional Banner

Topper's Solved these Questions

  • NTA NEET SET 94

    NTA MOCK TESTS|Exercise CHEMISTRY|45 Videos
  • NTA NEET SET 96

    NTA MOCK TESTS|Exercise CHEMISTRY|45 Videos

Similar Questions

Explore conceptually related problems

If molecular weight of a polypeptide is 15.3kDa, what would be the minimum number of nucleotides in the mRNA that codes for this polypeptide ? Assume that molecular weight of each amino acid is 90 Da.

Insulin (bovine) has 51 amino acids in A and B polypeptides. The polypeptide A possesses amino acids

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

In a polypeptide chain of 125 amino acids, if the 25^(th) amino acid is mutated to UAA, then :-

Assertion : Last amino acid of any proteins is known as c terminal amino acid Reason : Last amino acid of any protein posses free cooh group

Statement-1 : Gly-Ala is a structural isomer pf Ala-Gly. Statement-2 : In Al-Gly, Alanine is the N -terminal amino acid.

A polypeptide on complete hydrolysis gives three amino acids. How many sequences are possible for A polypeptide on complete hydrolysis gives three amino acids. How many sequences are possible for that polypeptide?

Which of the following statements regarding the structure of proinsulin and mature insulin are not correct ? (i) Proinsulin is made up of three polypeptide chains -A,B and C (ii) c- polypeptide chain with 33 amino acids is removed prior to insulin formation (iii) Mature insulin is made up of 51 amino acids arranged in two polypeptide chain -A and B (iv) Polypeptide chain A has 30 amino acids and polypeptide chain B has 21 amino acids (v) Polypeptide chains A and B are interconnected by only one S-S linkage.

The following sequence contains the open reading frame of a polypeptide. How many amino acids will the polypeptide consists of ? 5' AGCATATGATCGTTTCTCTGCTTTGAACT-3'

NTA MOCK TESTS-NTA NEET SET 95-CHEMISTRY
  1. In the reaction sequence CH3-CH2-COOHoverset(H2O2)rarr[X]overset(Delta...

    Text Solution

    |

  2. Volume of 0.1 M K2Cr2O7 required to oxidize 35 ml of 0.5 M FeSO4 solut...

    Text Solution

    |

  3. In the reaction sequence underset("(small)")(C6H5)-CH3overset(Cl2//hv)...

    Text Solution

    |

  4. The ratio of the value of any colligative property for K4[Fe(CN)6] to ...

    Text Solution

    |

  5. Which of the following reagents can be used for the test of carbonyl g...

    Text Solution

    |

  6. If the ionization enthalpy and electron gain enthalpy of an element ar...

    Text Solution

    |

  7. In the given polypeptide Arg- Try -Ile-Asn Gly C - terminus amino ...

    Text Solution

    |

  8. 0.73 g of orgainc compound on oxidation gave 1.32 g of carbon dioxide....

    Text Solution

    |

  9. What is the equation form of Langmuir adsorption isotherm undre high p...

    Text Solution

    |

  10. Which of the following oxoacids contains more than one S-S bonds ?

    Text Solution

    |

  11. Intermediate product of hydrolysis of cyanide is

    Text Solution

    |

  12. Which of the following solutions has maximum freezing point depression...

    Text Solution

    |

  13. In the following reaction HCO3^(-)+H2OhArrCO3^(2-)+H3O^+ which two sub...

    Text Solution

    |

  14. For a chemical reaction, m1A+m2B rarrn1C+n2D The ratio of rate of disa...

    Text Solution

    |

  15. Which of the following is correct order of sigma - bond strength ? ...

    Text Solution

    |

  16. What is the shape of the IBr2^- ion ?

    Text Solution

    |

  17. Two different first order reaction have rate constants k1 and k2 at T1...

    Text Solution

    |

  18. What is not applicable to ozone ?

    Text Solution

    |

  19. Match the list - I with List - II {:(,"List (Electrode)",,"List - II...

    Text Solution

    |

  20. Which of the following combination does not liberated NH(3) gas?

    Text Solution

    |