Home
Class 12
BIOLOGY
A: Polypeptide sequence are dictated by ...

A: Polypeptide sequence are dictated by DNA and represented by mRNA.
R: Sequence of amino acids in a polypeptide can be predicted by the exact sequence of nucleotides on the mRNA and template DNA.

A

If both Assertion & Reason are true and the reason is the correct explanation of the assertion, then mark

B

If both Assertion & Reason are true and the reason is not the correct explanation of the assertion , then mark

C

If Assertion is ture statement but Reason is false, then mark.

D

If both Assertion and Reason are false statements, then mark.

Text Solution

AI Generated Solution

The correct Answer is:
### Step-by-Step Solution: 1. **Understanding the Assertion (A)**: - The assertion states that polypeptide sequences are dictated by DNA and represented by mRNA. - This is true because DNA contains the genetic information that is transcribed into mRNA, which then serves as a template for protein synthesis. 2. **Understanding the Reason (R)**: - The reason states that the sequence of amino acids in a polypeptide can be predicted by the exact sequence of nucleotides on the mRNA and the template DNA. - This statement is partially true but misleading. While the sequence of amino acids is determined by the mRNA, the template DNA does not directly predict the amino acid sequence due to the presence of introns in the initial RNA transcript (pre-mRNA). 3. **Central Dogma of Molecular Biology**: - The central dogma explains the flow of genetic information: DNA → RNA → Protein. - DNA is transcribed into mRNA, and then mRNA is translated into a polypeptide (protein). 4. **Role of mRNA**: - mRNA is the mature transcript that contains only the coding sequences (exons) after splicing, which removes non-coding sequences (introns). - Therefore, the amino acid sequence is directly derived from the mRNA, not the original DNA sequence. 5. **Conclusion**: - The assertion (A) is true because DNA does dictate the polypeptide sequence through mRNA. - The reason (R) is false because the sequence of amino acids cannot be accurately predicted from the template DNA due to the presence of introns in the pre-mRNA. ### Final Answer: - Assertion (A) is true, and Reason (R) is false.
Promotional Banner

Topper's Solved these Questions

  • MOLECULAR BASIS OF INHERITANCE

    AAKASH INSTITUTE ENGLISH|Exercise ASSIGNMENT (SECTION -C) Previous Years Questions|139 Videos
  • MOCK_TEST_20

    AAKASH INSTITUTE ENGLISH|Exercise EXAMPLE|31 Videos
  • MORPHOLOGY OF FLOWERING PLANTS

    AAKASH INSTITUTE ENGLISH|Exercise TRY YOURSELF|38 Videos

Similar Questions

Explore conceptually related problems

The structure formed by the sequence of amino acids in a polypeptide chain is called :

Change in the sequence of nucleotide in DNA is called as

Amino acid sequence, in protein synthesis is decided by the sequence of

The given nucleotide sequence on mRNA is as shown below : 5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (A) How many amino acids will be inserted in a polypeptide chain under normal conditions? (B) How many amino acids will be inserted in a polypeptide chain in a mutated situation by the deletion of 9th nucleotide in the cistron part of DNA ?

Read the sequence of the nucleotides in the given segment of mRNA and the respective amino acid sequence in the polypeptide chain. Polypeptide: met-phe-met-pro-val-ser Write the nucleotide sequence of the DNA strand from which this mRNA was transcribed.

Assertion :- ESTs are the sequences in DNA that exprossed as RNA. Reason : Sequence Annotation is the blind approach of sequencing entire codeing sequence of genome.

If the sequence of bases in coding strand of DNA is ATTCGATC, then the sequence of bases in mRNA will be

Why are some untranslated sequence of bases seen in mRNA, coding for polypeptide? Where exactly are they present on mRNA?

Read the following statements. (i) One codon codes for only one amino acid. (ii) Some amino acids are coded by more than one codon. (iii) The sequence of triplet nitrogenous bases in DNA of mRNA coresponds to the amino acid sequence in the polypeptide chain. Give , suitabel terms for the characteristics of 'genetic code' as per the above statements.

Polymorphism in DNA sequences

AAKASH INSTITUTE ENGLISH-MOLECULAR BASIS OF INHERITANCE -ASSIGNMENT (SECTION -D) (Assertion -Reason Type Questions)
  1. A : RNA polymerase is of three types in eukaryotes for the synthesi...

    Text Solution

    |

  2. A: 5S rRNA and surrounding protein complex provides binding site o...

    Text Solution

    |

  3. A: Operator gene is functional when it is not blocked by repressor. ...

    Text Solution

    |

  4. A: Peptidyl transfer site is contributed by larger sub-unit of ribos...

    Text Solution

    |

  5. A: Teminism is unidirectional flow of information. R: It requires ...

    Text Solution

    |

  6. A : In bacterial translation mechanism, either of the two tRNA are r...

    Text Solution

    |

  7. A: Nutritional mutant strain of pink mould is auxotroph. R: It is...

    Text Solution

    |

  8. A : DNA fingerprinting are important to scientists in human genomic...

    Text Solution

    |

  9. A : c-DNA libraries are important to scientists in human genomics. ...

    Text Solution

    |

  10. A : SNPs- pronounced ''snips '' are common in human genome. R : It...

    Text Solution

    |

  11. A : Catalytic functions were assigned to RNA molecule during evolut...

    Text Solution

    |

  12. A : Kornberg enzyme is asscoitated with the removal of primers an...

    Text Solution

    |

  13. A : Wobbling reduces the number of tRNAs required for polypeptides s...

    Text Solution

    |

  14. A : Unknown DNA after hybridization with VNTR probe, the autoradiogr...

    Text Solution

    |

  15. A: Polypeptide sequence are dictated by DNA and represented by mRNA. ...

    Text Solution

    |

  16. A: Triplet genetic code can be confirmed by frame shift mutations. ...

    Text Solution

    |

  17. Lac operan exerts negative control when (1). Repressor binds prom...

    Text Solution

    |

  18. A : Single DNA depenedent RNA polymerase catalyases transcription of...

    Text Solution

    |

  19. A : Sigma factor of RNA polymerase recognizes the start single regio...

    Text Solution

    |

  20. A: HGP was completed in 2003 by sequencing all genes of all chrom...

    Text Solution

    |